ࡱ > X + + G+ H+ I+ J+ K+ L+ M+ N+ O+ P+ Q+ R+ S+ T+ U+ V+ W+ X+ Y+ Z+ [+ \+ ]+ ^+ _+ `+ a+ b+ c+ d+ e+ f+ g+ h+ i+ j+ k+ l+ m+ n+ o+ p+ q+ r+ s+ t+ u+ v+ w+ x+ y+ z+ {+ |+ }+ ~+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + ' L bjbj $ !h!hS
d d d d d <" 4 ! H $# $# $# $# %! ! D ! $ O" Q" Q" Q" Q" Q" Q" $ p" &" P u" 3! ! " %! 3! 3! u" $# $# ! " " " " 3! R $# $# " p " 3! O" " " " " $# t. " : " " " 0 <" " v" " v" " v" " 3! 3! " 3! 3! 3! 3! 3! u" u" " 3! 3! 3! <" 3! 3! 3! 3! v" 3! 3! 3! 3! 3! 3! 3! 3! 3!
X R : Genome Characteristics Reveal the Biocontrol Potential of Actinobacteria isolated from Sugarcane Rhizosphere
Author information
Zhen Wang1,2,3, Manoj Kumar Solanki4, Zhuo-Xin Yu3, Muhammad Anas3, Deng-Feng Dong3, Yong-Xiu Xing3, Mukesh Kumar Malviya2, Fei Pang1*, Yang-Rui Li2,3*
1College of Biology and Pharmacy, Guangxi Key Laboratory of Agricultural Resources Chemistry and Biotechnology, Yulin Normal University, Yulin, 537000, China
2Key Laboratory of Sugarcane Biotechnology and Genetic Improvement (Guangxi), Ministry of Agriculture, Guangxi Key Laboratory of Sugarcane Genetic Improvement, Sugarcane Research Institute of Guangxi Academy of Agricultural Sciences, Nanning, 530000, China.
3Agricultural College, Guangxi University, Nanning, 530000, China
4Plant Cytogenetics and Molecular Biology Group, Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Scienc e s , U n i v e r s i t y o f S i l e s i a i n K a t o w i c e , 4 0 0 3 2 K a t o w i c e , P o l a n d
T h e s e a u t h o r s h a v e c o n t r i b u t e d e q u a l l y t o t h i s w o r k
* C o r r e s p o n d i n g A u t h o r
R u n n i n g t i t l e : S u g a r c a n e a c t i n o b a c t e r i a a s a b i o c o n t r o l a g e n t
T a b l e S S E Q T a b l e \ * A R A B I C 1 P C R r e a c t i o n c o n d i tions for 16S rRNA gene and secondary metabolite synthesis genes
GenePrimerSequence (5-3)Size (bp)PCR conditionsReferences16S rRNA27FAGAGTTTGATCCTGGCTCAG1400-1500Initial denaturation 94 C for 5 min, 35 cycles of 94 C for 55 s, 50 C for 50 s, and 72 C for 1 min, final extension 72 C for 10 min HYPERLINK \l "_ENREF_59" \o "Lane, 1991 #2770" ADDIN EN.CITE Lane19912770Lane (1991)277027705Lane, D. J.Stackebrandt, E.Goodfellow, M.16S/23S rRNA sequencingNucleic acid techniques in bacterial systematics115-1751991John Wiley and SonsLane (1991)1492RTACGGCTACCTTGTTACGACTTPKS IKSMA-FTSGCSATGGACCCSCAGCAG700Initial denaturation 94 C for 5 min, 35 cycles of 94 C for 1 min, 60 C for 1 min, and 72 C for 2 min, final extension 72 C for 5 min HYPERLINK \l "_ENREF_47" \o "Izumikawa, 2003 #2715" ADDIN EN.CITE Izumikawa20032715Izumikawa et al. (2003)2715271517Izumikawa, MihoMurata, MichioTachibana, KazuoEbizuka, YutakaFujii, IsaoBioorganic & Medicinal ChemistryBioorganic & Medicinal ChemistryBiorg. Med. Chem.Biorg Med Chem3401-34051116enantioselective dispositionantiinflammatory drugspharmacokineticsmetabolic eliminationchiralenantiomerstereoisomerism2003Izumikawa et al. (2003)KSMB-RCCSGTSCCGTGSGCCTCSACPKS II540FGGITGCACSTCIGGIMTSGAC554Initial denaturation 94 C for 5 min, 40 cycles of 94 C for 1 min, 64 C for 1 min, and 72 C for 1.5 min, final extension 72 C for 15 min HYPERLINK \l "_ENREF_121" \o "Wawrik, 2005 #2722" ADDIN EN.CITE Wawrik20052722Wawrik et al. (2005)2722272217Wawrik, Boris,Kerkhof, Lee,Zylstra, Gerben J,Kukor, Jerome J,Identification of unique type II polyketide synthase genes in soilApplied & Environmental MicrobiologyApplied and Environmental MicrobiologyAppl. Environ. Microbiol.Appl Environ MicrobiolApplied & Environmental Microbiology2232-8715Identification of Unique Type II Polyketide Synthase Genes in Soil, Artculo2005Wawrik et al. (2005)1100RCCGATSGCICCSAGIGAGTGNRPSA3FGCSTACSYSATSTACACSTCSGG700Initial denaturation 95 C for 5 min, 35 cycles of 95 C for 30 s, 59 C for 2 min, and 72 C for 4 min, final extension 72 C for 10 min HYPERLINK \l "_ENREF_5" \o "Ayuso-Sacido, 2005 #2709" ADDIN EN.CITE Ayuso-Sacido20052709Ayuso-Sacido and Genilloud (2005)2709270917Ayuso-Sacido, A.Genilloud, O.New PCR Primers for the Screening of NRPS and PKS-I Systems in Actinomycetes: Detection and Distribution of These Biosynthetic Gene Sequences in Major Taxonomic GroupsMicrobial EcologyMicrobial EcologyMicrob. Ecol.Microb Ecol10-24491ActinobacteriaPolyketide SynthasesPeptide SynthasesDNA PrimersElectrophoresis, Agar GelCloning, MolecularSequence Analysis, DNABase SequenceConserved SequenceGenome, Bacterial2005Ayuso-Sacido and Genilloud (2005)A7RSASGTCVCCSGTSCGGTASHaloFWTTCCCSCGSTACCASATCGGSGAG500Initial denaturation 94 C for 3 min, 30 cycles of 94 C for 1 min, 58 C for 90 s, and 72 C for 1 min, final extension 72 C for 5 min HYPERLINK \l "_ENREF_43" \o "Hornung, 2010 #2714" ADDIN EN.CITE Hornung20102714Hornung et al. (2010)2714271417Hornung, ABertazzo, MDziarnowski, ASchneider, KWelzel, KWohlert, S. E.Holzenkmpfer, MNicholson, G. J.Bechthold, ASssmuth, R. D.Vente, AA genomic screening approach to the structure-guided identification of drug candidates from natural sourcesChembiochemChemBioChemChemBioChemChemBioChem757-76687actinomycetesbiosynthesisgenetic screeninghalogenasenatural products2010Hornung et al. (2010)RVGSGGGATSWMCCAGWACCASCCphzEphzEfGAAGGCGCCAACTTCGTYATCAA450Initial denaturation 94 C for 2 min, 35 cycles of 94 C for 1 min, 55 C for 1 min, and 72 C for 2 min, final extension 72 C for 6 min HYPERLINK \l "_ENREF_95" \o "Schneemann, 2011 #2719" ADDIN EN.CITE Schneemann20112719Schneemann et al. (2011)2719271917Schneemann, Imke,Wiese, Jutta,Kunz, Anna Lena,Imhoff, Johannes F,Genetic approach for the fast discovery of phenazine producing bacteriaMarine DrugsMarine DrugsMar. DrugsMar Drugs772-78995phenazineActinobacteriaoligonucleotidesHPLC-UV/MS2011Schneemann et al. (2011)phzErGCCYTCGATGAAGTACTCGGTGTGdTGDdTGD-1GSGGSGSSGCSGGSTTCATSGG600Initial denaturation 95 C for 4 min, 40 cycles of 94 C for 40 s, 50 C for 40 s, and 72 C for 90 s, final extension 72 C for 5 min HYPERLINK \l "_ENREF_27" \o "Du, 2004 #2712" ADDIN EN.CITE Du20042712Du et al. (2004)2712271217Du, Y.Li, T.Wang, Y. G.Xia, H.Current MicrobiologyCurrent MicrobiologyCurr. Microbiol.Curr Microbiol99-107492Chromosomes, BacterialClostridiumStreptomycesPseudomonas putidaXanthomonasHydro-LyasesGlycosyltransferasesMannosyltransferasesRhamnoseKanamycin2004Du et al. (2004)dTGD-2GGGWRCTGGYRSGGSCCGTAGTTGCYPPEH-1TGGATCGGCGACGACCGSVYCGT350Initial denaturation 94 C for 5 min, 45 cycles of 94 C for 1 min, 60 C for 30 s, and 72 C for 45 s, final extension 72 C for 5 min HYPERLINK \l "_ENREF_61" \o "Lee, 2006 #2717" ADDIN EN.CITE Lee20062717Lee et al. (2006)2717271717Lee, Mi YeonMyeong, Ji Seon,Park, Hyun JooHan, KyuboemKim, Eung SooJournal of Industrial Microbiology & BiotechnologyJournal of Industrial Microbiology & BiotechnologyJ. Ind. Microbiol. Biotechnol.J Ind Microbiol Biotechnol84-87332PolyenePolyketideAntifungalCryptic gene clusterPseudonocardiaCytochrome P450 hydroxylase2006Lee et al. (2006)PEH-2CCGWASAGSAYSCCGTCGTACTTLane, D.J. (1991) 16S/23S rRNA sequencing. In Nucleic acid techniques in bacterial systematics. Stackebrandt, E., and Goodfellow, M. (eds). Now York: John Wiley and Sons, pp. 115-175.
Izumikawa, M., Murata, M., Tachibana, K., Ebizuka, Y., and Fujii, I. (2003) Cloning of modular type I polyketide synthase genes from salinomycin producing strain of streptomyces albus. Biorg Med Chem 11: 3401-3405.
Wawrik, B., Kerkhof, L., Zylstra, G.J., and Kukor, J.J. (2005) Identification of unique type II polyketide synthase genes in soil. Appl Environ Microbiol 71: 2232-2238.
Ayuso-Sacido, A., and Genilloud, O. (2005) New PCR Primers for the Screening of NRPS and PKS-I Systems in Actinomycetes: Detection and Distribution of These Biosynthetic Gene Sequences in Major Taxonomic Groups. Microb Ecol 49: 10-24.
Hornung, A., Bertazzo, M., Dziarnowski, A., Schneider, K., Welzel, K., Wohlert, S.E. et al. (2010) A genomic screening approach to the structure-guided identification of drug candidates from natural sources. ChemBioChem 8: 757-766.
Schneemann, I., Wiese, J., Kunz, A.L., and Imhoff, J.F. (2011) Genetic approach for the fast discovery of phenazine producing bacteria. Mar Drugs 9: 772-789.
Du, Y., Li, T., Wang, Y.G., and Xia, H. (2004) Identification and functional analysis of dTDP-Glucose-4,6-dehydratase gene and its linked gene cluster in an aminoglycoside antibiotics producer of Streptomyces tenebrarius H6. Curr Microbiol 49: 99-107.
Lee, M.Y., Myeong, J.S., Park, H.J., Han, K., and Kim, E.S. (2006) Isolation and partial characterization of a cryptic polyene gene cluster in Pseudonocardia autotrophica. J Ind Microbiol Biotechnol 33: 84-87.
Table S2 PCR reaction system for detecting secondary metabolite synthase genes
Reaction component V o l u m e ( L ) 2 G o l d S t a r M a s t e r M i x a 1 2 . 5 T e m p l a t e D N A ( 3 0 n g L - 1 ) 1 P r i m e r - F 1 P r i m e r - R 1 d d H 2 O 9 . 5 T o t a l 2 5 a p u r c h a s e d f r o m C W B I O B i o t e c h n o l o g y ( B e i j i n g ) C o . , L t d .
T a b l e S 3 A n t a g o n i s m o f a c t i n o b a c t e r i a a n d p h y t o p a t h o g e n i c f u n g i i n v i t r o
I s o l a t esSugarcane smut diseaseSugarcane pineapple diseaseBanana Fusarium wilt diseaseTomaoto gray moldRice sheath blightWatermelon wilt diseaseBlack leaf spot of Chinese cabbagePepper anthracnoseSouthern corn leaf blightSporisorium scitamineumCeratocystis paradoxa (de Seynes) MoreauFusarium oxysporum f. sp. CubenseBotrytis cinereaRhizoctonia solaniFusarium oxysporun f. sp. NiveumAlternaria brassicicolaColletotrichum acutatumCochliobolus heterostrophusTU2+++++++++---++TU3+++++++---++++TU4--+----++TU5--+----++++TU6+++-++-++++-TU7--------++TU8++-++++-++++-TU10++++++++++++++-TU11-+++++++++--TU12-+-+++---+TU13++++++++++++++++++-TU14-++-++++++++-TU15++++++++-++-TU16+++++++++++++++++++++-TU17--++-+---TU19-++++++-++-TU20---+-----TU21+--+-----TU22--+-+---++TU23++--+--++--TU32-+++++++++++++++TU33++++++++-++-BTU1-+++--+--BTU2++-+-----BTU3----++++++--+BTU4----++++++-++-BTU5-+++++++++++++++++-BTU6+++++++++++++++++++-+++BTU8++++++++++++++++-+++BTU9+-------+BTU10++-+--++-BTU11---+-----BTU12--++-----BTU13+++++++++++-+-BTU14+++-++++--+++BTU16-++++++++++++-BTU17---++++----BTU18---+---+-BTU19++++++---+++-+++BTU20-++++++-++++++++++-BTU21-+-+++---BTU22--++-----GEN1------+--GEN2+-+++--++++GEN5---+++-++++GEN7--+-+++++++-GEN8++++-+++--+-++GEN15-++-+--+--WZS021+++-+++-++-WZS023--++++--+WZS027-+++++-+++-+++++++WZS028++++++-+++++++++++WZS030+++++++-+++++WZS031++++++-+++++-++++++++WZS035-----++--WZS050-++++++++++++WZS051+-+++++--+++-WZS221+---++---Total (Percentage of total isolates)31 (53%)33 (57%)34 (59%)42 (72%)35 (60%)23 (40%)34 (59%)30 (52%)23 (40%)Note: +, growth definitely retarded, with obvious zone of inhibition near colony; ++, with zone of inhibition of e"1 0 m m ; + + + , w i t h z o n e o f i n h i b i t i o n o f e"1 5 m m ; - , n o i n h i b i t i o n .
T a b l e S 4 S c r e e n i n g o f s y n t h e t i c g e n e s f o r s e c o n d a r y m e t a b o l i t e s o f a c t i n o b a c t e r i a
I s o l a t e s P K S I P K S I I N R P S H a l o p h z E d T G D C Y P T U 2 - - - - - + + T U 3 + + + - + - + T U 4 + + + - + - + T U 5++-----TU6-+--+-+TU7++++++-TU8++++---TU10-+-+-+-TU11+++-++-TU12++++-+-TU13++-+++-TU14++++-+-TU15++++++-TU16-+--+-+TU17-+----+TU19-+-+-+-TU20++++++-TU21+++-+--TU22-++----TU23+++-+--TU32-+++++-TU33++++++-BTU1-+-+-+-BTU2++--+-+BTU3-++-+-+BTU4-+--+-+BTU5++--+++BTU6++-+-++BTU8-+++-++BTU9+++-++-BTU10-++++++BTU11-+---++BTU12++-+-++BTU13-+-+-++BTU14-+-+-+-BTU16-+++-++BTU17+++-+-+BTU18+++-+-+BTU19++++-++BTU20-++-+-+BTU21--++-++BTU22+-++---GEN1++--+--GEN2++-+---GEN5-+----+GEN7+++--+-GEN8++++---GEN15+-+--+-WZS021+--+++-WZS023+-+--++WZS027+--+-+-WZS028++++++-WZS030+-+-+-+WZS031---+---WZS035++-+++-WZS050++-+++-WZS051-+----+WZS221+--+-+-Total (Percentage of total isolates)36 (62%)48 (83%)31 (53%)31 (53%)28 (48%)34 (59%)26 (45%)Note: -, negative; +, positive.
Table S5 Genomic characteristics of actinobacterial strain S. griseorubiginosus BTU6
AttributeValueNumber of all scaffolds1Genome size (bp)9,226,027GC content (%)71.15rRNA18tRNA73other ncRNA42Protein-coding genes (CDS)8,110Pseudogene number5Seconda m n o
>
Ʒzk h g h5K CJ OJ QJ aJ h5K CJ OJ QJ aJ h5K h5K CJ OJ QJ aJ "h g h g CJ H*OJ QJ aJ o( h g h g CJ H*OJ QJ aJ h g h g CJ OJ QJ aJ h g h g 5CJ OJ QJ aJ %h g h g B*CJ OJ QJ aJ ph ,h g h g 5B*CJ KH OJ QJ aJ ph &