Please wait while sequence viewer is loading...

rboAnalyzer report

BLAST output file:   WNGTW72H014-Alignment_cnidaria.xml
Query sequence file: u2_reg.fasta

RFAM model with best score to a query sequence   
?
Infered from query sequence by cmscan program.
Family name: U2 E-value: 5e-25

Hit: NW_018384369.1

NW_018384369.1 Exaiptasia pallida isolate CC7 unplaced genomic scaffold, Aiptasia genome 1.1 scaffold1243, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 172.0 bits (156.4), Expect = 4.90E-36 Identities = 143/176 (81%), Gaps = 5/176 (3%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct 1696 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATACG 1629 Query 69 -TCCTCTATCCGAG--GACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCT 133 | ||| || |||| | |||||||||| |||||||||| | ||| ||||| || |||||| Sbjct 1628 CTGCTC-AT-CGAGTAGCTCATATATTAAACTGATTTTTGGAACTGGGCTGTGGAAAAGAGGCTTGCC 1563 Query 134 CTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 |||| ||||| | | | ||||||||| ||||||| Sbjct 1562 TCGTCCCAGCCACGGGTTGTCTCGGTATTGCACTACCTCC 1523
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
1508
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1696
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
164.95
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_018384369.1

NW_018384369.1 Exaiptasia pallida isolate CC7 unplaced genomic scaffold, Aiptasia genome 1.1 scaffold1243, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 172.0 bits (156.4), Expect = 4.90E-36 Identities = 143/176 (81%), Gaps = 5/176 (3%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct 3280 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATACG 3213 Query 69 -TCCTCTATCCGAG--GACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCT 133 | ||| || |||| | |||||||||| |||||||||| | ||| ||||| || |||||| Sbjct 3212 CTGCTC-AT-CGAGTAGCTCATATATTAAACTGATTTTTGGAACTGGGCTGTGGAAAAGAGGCTTGCC 3147 Query 134 CTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 |||| ||||| | | | ||||||||| ||||||| Sbjct 3146 TCGTCCCAGCCACGGGTTGTCTCGGTATTGCACTACCTCC 3107
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
3092
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
3280
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
164.95
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_018384369.1

NW_018384369.1 Exaiptasia pallida isolate CC7 unplaced genomic scaffold, Aiptasia genome 1.1 scaffold1243, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 172.0 bits (156.4), Expect = 4.90E-36 Identities = 143/176 (81%), Gaps = 5/176 (3%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct 4864 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATACG 4797 Query 69 -TCCTCTATCCGAG--GACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCT 133 | ||| || |||| | |||||||||| |||||||||| | ||| ||||| || |||||| Sbjct 4796 CTGCTC-AT-CGAGTAGCTCATATATTAAACTGATTTTTGGAACTGGGCTGTGGAAAAGAGGCTTGCC 4731 Query 134 CTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 |||| ||||| | | | ||||||||| ||||||| Sbjct 4730 TCGTCCCAGCCACGGGTTGTCTCGGTATTGCACTACCTCC 4691
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
4676
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
4864
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
164.95
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_018384369.1

NW_018384369.1 Exaiptasia pallida isolate CC7 unplaced genomic scaffold, Aiptasia genome 1.1 scaffold1243, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 172.0 bits (156.4), Expect = 4.90E-36 Identities = 143/176 (81%), Gaps = 5/176 (3%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct 6448 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATACG 6381 Query 69 -TCCTCTATCCGAG--GACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCT 133 | ||| || |||| | |||||||||| |||||||||| | ||| ||||| || |||||| Sbjct 6380 CTGCTC-AT-CGAGTAGCTCATATATTAAACTGATTTTTGGAACTGGGCTGTGGAAAAGAGGCTTGCC 6315 Query 134 CTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 |||| ||||| | | | ||||||||| ||||||| Sbjct 6314 TCGTCCCAGCCACGGGTTGTCTCGGTATTGCACTACCTCC 6275
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
6260
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
6448
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
164.95
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_018384369.1

NW_018384369.1 Exaiptasia pallida isolate CC7 unplaced genomic scaffold, Aiptasia genome 1.1 scaffold1243, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 172.0 bits (156.4), Expect = 4.90E-36 Identities = 143/176 (81%), Gaps = 5/176 (3%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct 8032 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATACG 7965 Query 69 -TCCTCTATCCGAG--GACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCT 133 | ||| || |||| | |||||||||| |||||||||| | ||| ||||| || |||||| Sbjct 7964 CTGCTC-AT-CGAGTAGCTCATATATTAAACTGATTTTTGGAACTGGGCTGTGGAAAAGAGGCTTGCC 7899 Query 134 CTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 |||| ||||| | | | ||||||||| ||||||| Sbjct 7898 TCGTCCCAGCCACGGGTTGTCTCGGTATTGCACTACCTCC 7859
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
7844
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
8032
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
164.95
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_018384369.1

NW_018384369.1 Exaiptasia pallida isolate CC7 unplaced genomic scaffold, Aiptasia genome 1.1 scaffold1243, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 172.0 bits (156.4), Expect = 4.90E-36 Identities = 143/176 (81%), Gaps = 5/176 (3%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct 9616 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATACG 9549 Query 69 -TCCTCTATCCGAG--GACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCT 133 | ||| || |||| | |||||||||| |||||||||| | ||| ||||| || |||||| Sbjct 9548 CTGCTC-AT-CGAGTAGCTCATATATTAAACTGATTTTTGGAACTGGGCTGTGGAAAAGAGGCTTGCC 9483 Query 134 CTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 |||| ||||| | | | ||||||||| ||||||| Sbjct 9482 TCGTCCCAGCCACGGGTTGTCTCGGTATTGCACTACCTCC 9443
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
9428
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
9616
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
164.95
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021126809.1

NW_021126809.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.Sc0000438, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 135528 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 135591 Query 65 TACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAG 127 |||| | ||| | | | |||||||||| |||||||||| | ||| ||||| || | Sbjct 135592 TACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGG 135655 Query 128 CTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||||| |||| ||||| | | | ||||| ||| ||||||| Sbjct 135656 CTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 135701
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
135528
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
135716
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021126809.1

NW_021126809.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.Sc0000438, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 177315 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 177378 Query 65 TACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAG 127 |||| | ||| | | | |||||||||| |||||||||| | ||| ||||| || | Sbjct 177379 TACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGG 177442 Query 128 CTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||||| |||| ||||| | | | ||||| ||| ||||||| Sbjct 177443 CTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 177488
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
177315
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
177503
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021126809.1

NW_021126809.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.Sc0000438, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 98.0 bits (89.7), Expect = 5.98E-16 Identities = 49/49 (100%), Gaps = 0/49 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 152754 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 152802
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
152754
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
152947
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
26.32
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021126809.1

NW_021126809.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.Sc0000438, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 90.0 bits (82.4), Expect = 8.88E-14 Identities = 101/137 (74%), Gaps = 1/137 (1%) Strand = Plus/Plus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGAT 100 ||||||||||||||| ||||||||||||||| | ||| | | | |||||||||| ||| Sbjct 184948 ATCTGTTCTTATCAGCTTAATATCTGATACGCTGCTCATTGAGCAGCTCATATATTAAACTGAT 185011 Query 101 TTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGC 164 ||||||| | ||| ||||| || |||||| |||| ||||| | | | ||||| || Sbjct 185012 TTTTGGAACCGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGC 185075 Query 165 AGTACCTCC 173 | ||||||| Sbjct 185076 ACTACCTCC 185084
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
184907
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
185099
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
108.54
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021126809.1

NW_021126809.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.Sc0000438, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 85.0 bits (77.9), Expect = 3.77E-12 Identities = 109/152 (72%), Gaps = 1/152 (1%) Strand = Plus/Plus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATA-CGTCCTCTATCCGAGGACAATATATTAAATGGATTTTT 104 ||||||||||||||| ||||||||||||| | | ||| | | | |||||||||| ||||||| Sbjct 2764 ATCTGTTCTTATCAGCTTAATATCTGATACCCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTT 2831 Query 105 GGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTC 172 ||| | ||| ||||| || |||||| |||| ||||| | | | ||||| | | |||||| Sbjct 2832 GGAACCGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGGACTACCTC 2899 Query 173 CAGGACCGGTGCACTT 188 || | ||| ||||| Sbjct 2900 CAAGCACGGCCCACTT 2915
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
2727
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
2915
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
88.83
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021126809.1

NW_021126809.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.Sc0000438, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 80.0 bits (73.4), Expect = 4.60E-11 Identities = 99/137 (72%), Gaps = 1/137 (1%) Strand = Plus/Plus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGATTT 102 ||||||||||||||| | ||||||||||| | | ||| | | | |||||||||| ||||| Sbjct 11191 ATCTGTTCTTATCAGCTCAATATCTGATATGCTGCTCATTGAGCAGCTCATATATTAAACTGATTT 11256 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTA 168 ||||| | ||| ||||| || |||||| ||||| ||||| | | | |||| ||| || Sbjct 11257 TTGGAACCGGGCTGTGGAAAAGAGGCTTGCCTTGTCCCAGCCACGGGTTGCCTCAGTATAGCACTA 11322 Query 169 CCTCC 173 ||||| Sbjct 11323 CCTCC 11327
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
11154
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
11342
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
86.69
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021126809.1

NW_021126809.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.Sc0000438, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 69.0 bits (63.5), Expect = 8.31E-08 Identities = 36/37 (97%), Gaps = 0/37 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGT 37 ||||||||||||||||||| ||||||||||||||||| Sbjct 116348 ATCGCTTCTCGGCCTTTTGACTAAGATCAAGTGTAGT 116384
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
116348
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
116533
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
19.0
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021126809.1

NW_021126809.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.Sc0000438, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 63.0 bits (58.1), Expect = 3.53E-06 Identities = 56/71 (79%), Gaps = 1/71 (1%) Strand = Plus/Plus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGATTT 102 ||||||||||||||| ||||||||||||||| | ||| | | | ||| |||||| ||||| Sbjct 77199 ATCTGTTCTTATCAGCTTAATATCTGATACGCTGCTCATTGAGCAGCTCATACATTAAACTGATTT 77264 Query 103 TTGGA 107 ||||| Sbjct 77265 TTGGA 77269
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
77164
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
77348
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
24.42
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Ambiguous base detected in uid:13|NW_021126809.1fw, violating base NN, pos 126

Hit: NW_021126809.1

NW_021126809.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.Sc0000438, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 58.0 bits (53.6), Expect = 4.31E-05 Identities = 32/34 (94%), Gaps = 0/34 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGT 34 |||||||||||||||||||||||||||| |||| Sbjct 137356 ATCGCTTCTCGGCCTTTTGGCTAAGATCTTGTGT 137389
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
137356
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
137525
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
16.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021126809.1

NW_021126809.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.Sc0000438, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 56.0 bits (51.8), Expect = 1.50E-04 Identities = 28/28 (100%), Gaps = 0/28 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATC 28 |||||||||||||||||||||||||||| Sbjct 138904 ATCGCTTCTCGGCCTTTTGGCTAAGATC 138931
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
138904
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
139090
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
18.92
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021126809.1

NW_021126809.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.Sc0000438, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 51.0 bits (47.3), Expect = 6.39E-03 Identities = 27/28 (96%), Gaps = 0/28 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATC 28 ||||||||||||||||||||||||| || Sbjct 87874 ATCGCTTCTCGGCCTTTTGGCTAAGTTC 87901
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
87874
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
88067
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-1.17
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021126809.1

NW_021126809.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.Sc0000438, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 50.0 bits (46.4), Expect = 6.39E-03 Identities = 25/25 (100%), Gaps = 0/25 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 ||||||||||||||||||||||||| Sbjct 78760 ATCGCTTCTCGGCCTTTTGGCTAAG 78784
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
78760
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
78969
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-4.8100000000000005
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021126809.1

NW_021126809.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.Sc0000438, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 46.0 bits (42.8), Expect = 7.79E-02 Identities = 26/28 (93%), Gaps = 0/28 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATC 28 ||||||||||||||||||||| ||| || Sbjct 23874 ATCGCTTCTCGGCCTTTTGGCAAAGCTC 23901
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
23874
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
24052
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-13.52
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021126809.1

NW_021126809.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.Sc0000438, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 40.0 bits (37.4), Expect = 3.31E+00 Identities = 23/25 (92%), Gaps = 0/25 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 || ||||||||||||||| |||||| Sbjct 55486 ATTGCTTCTCGGCCTTTTCGCTAAG 55510
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
55486
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
55683
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-10.01
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021126939.1

NW_021126939.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.Sc0000568, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 60715 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 60780 Query 67 CG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTG 131 || | ||| | | | |||||||||| |||||||||| | ||| ||||| || ||||| Sbjct 60781 CGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGGCTTG 60846 Query 132 CTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 | |||| ||||| | | | ||||| ||| ||||||| Sbjct 60847 CCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 60888
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
60715
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
60903
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021126939.1

NW_021126939.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.Sc0000568, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 85697 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 85762 Query 67 CG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTG 131 || | ||| | | | |||||||||| |||||||||| | ||| ||||| || ||||| Sbjct 85763 CGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGGCTTG 85828 Query 132 CTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 | |||| ||||| | | | ||||| ||| ||||||| Sbjct 85829 CCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 85870
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
85697
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
85885
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021126939.1

NW_021126939.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.Sc0000568, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 121.0 bits (110.4), Expect = 6.39E-22 Identities = 88/105 (84%), Gaps = 1/105 (1%) Strand = Plus/Plus Query 4 GCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG- 68 ||||||||| ||||||||||||||||||||||| |||||||||||||| ||||||||||||||| Sbjct 99250 GCTTCTCGGTTTTTTGGCTAAGATCAAGTGTAGTGTCTGTTCTTATCAGCTTAATATCTGATACGC 99315 Query 69 TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGA 107 | ||| | | | |||||||||| |||||||||| Sbjct 99316 TGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGA 99354
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
99247
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
99433
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
58.95
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021126939.1

NW_021126939.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.Sc0000568, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 90.0 bits (82.4), Expect = 8.88E-14 Identities = 101/137 (74%), Gaps = 1/137 (1%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGATTT 102 ||||||||||||||| ||||||||||||||| | ||| | | | |||||||||| ||||| Sbjct 30391 ATCTGTTCTTATCAGCTTAATATCTGATACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTT 30326 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTA 168 ||||| | ||| ||||| || |||||| |||| ||||| | | | ||||| ||| || Sbjct 30325 TTGGAACCGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTA 30260 Query 169 CCTCC 173 ||||| Sbjct 30259 CCTCC 30255
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
30243
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
30428
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
97.05
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021126939.1

NW_021126939.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.Sc0000568, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 74.0 bits (68.0), Expect = 1.96E-09 Identities = 104/145 (72%), Gaps = 4/145 (3%) Strand = Plus/Plus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGATTT 102 |||||||| |||||| |||||||||||| || | ||| | | | |||||||||| ||||| Sbjct 62213 ATCTGTTCGTATCAGCTTAATATCTGATTCGCTGCTCATTGAGCAGCTCATATATTAAACTGATTT 62278 Query 103 TTGGAGCAGGGAGATGG-AATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGT 167 ||||| | ||| ||| || || |||||| |||| ||||| | | | ||||| ||| | Sbjct 62279 TTGGAACCGGGCTGTGGCAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACT 62344 Query 168 ACCTCCAGGACCG 180 |||||| ||||| Sbjct 62345 ACCTCC--GACCG 62355
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
62176
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
62365
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
85.1
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021126939.1

NW_021126939.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.Sc0000568, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 68.0 bits (62.6), Expect = 8.31E-08 Identities = 34/34 (100%), Gaps = 0/34 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGT 34 |||||||||||||||||||||||||||||||||| Sbjct 34780 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGT 34747
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
34593
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
34787
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
20.87
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021126939.1

NW_021126939.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.Sc0000568, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 45.0 bits (41.9), Expect = 2.72E-01 Identities = 24/25 (96%), Gaps = 0/25 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 |||||||||| |||||||||||||| Sbjct 20354 ATCGCTTCTCAGCCTTTTGGCTAAG 20330
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
20167
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
20335
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-1.22
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021126939.1

NW_021126939.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.Sc0000568, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 41.0 bits (38.3), Expect = 3.31E+00 Identities = 25/28 (89%), Gaps = 0/28 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATC 28 ||||||||||||||||||| |||| || Sbjct 10316 ATCGCTTCTCGGCCTTTTGAGTAAGGTC 10289
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
10129
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
10306
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-8.95
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021127469.1

NW_021127469.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xfSc0000099, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 171994 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 171931 Query 65 TACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAG 127 |||| | ||| | | | |||||||||| |||||||||| | ||| ||||| || | Sbjct 171930 TACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGG 171867 Query 128 CTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||||| |||| ||||| | | | ||||| ||| ||||||| Sbjct 171866 CTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 171821
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
171806
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
171994
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021127469.1

NW_021127469.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xfSc0000099, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 61.0 bits (56.3), Expect = 1.23E-05 Identities = 99/141 (70%), Gaps = 9/141 (6%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACA----ATATATTAAATGGATTT 102 |||||||||||| || ||||||||||||||| | ||| || | ||| |||||||||| |||| Sbjct 878 ATCTGTTCTTATAAGCTTAATATCTGATACGCTGCTC-AT---TGAACAGCTCATATATTAAACTAATTT 813 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTC 172 ||||| | || ||||| || |||||| |||| |||| | | | |||| ||| |||||| Sbjct 812 TTGGAACTAGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACTGGTTGCCTCGGTACAGCACTACCTC 743 Query 173 C 173 | Sbjct 742 C 742
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
723
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
915
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
69.66
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021127469.1

NW_021127469.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xfSc0000099, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 51.0 bits (47.3), Expect = 6.39E-03 Identities = 87/127 (69%), Gaps = 7/127 (6%) Strand = Plus/Plus Query 48 ATCAGTTTAATATCTGATAC-GTCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGG 112 ||||| |||||||||||||| || ||| | | | || ||||||| |||||||||| | | Sbjct 49378 ATCAGCTTAATATCTGATACGGTGCTCATTGAGCAGCTCATGTATTAAACTGATTTTTGGAACCG- 49442 Query 113 GAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 |||| || |||||| |||| ||| | | | | |||||| ||| ||||||| Sbjct 49443 -----GGAAAAGAGGCTTGCCTCGTCCCAGCCATGGGTTGCCTTGGTATAGCACTACCTCC 49498
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
49341
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
49513
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
64.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021127469.1

NW_021127469.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xfSc0000099, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 50.0 bits (46.4), Expect = 6.39E-03 Identities = 25/25 (100%), Gaps = 0/25 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 ||||||||||||||||||||||||| Sbjct 163136 ATCGCTTCTCGGCCTTTTGGCTAAG 163112
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
162949
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
163130
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-0.56
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021127469.1

NW_021127469.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xfSc0000099, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 50.0 bits (46.4), Expect = 6.39E-03 Identities = 25/25 (100%), Gaps = 0/25 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 ||||||||||||||||||||||||| Sbjct 166663 ATCGCTTCTCGGCCTTTTGGCTAAG 166639
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
166476
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
166667
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
6.13
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021127469.1

NW_021127469.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xfSc0000099, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 49.0 bits (45.5), Expect = 2.23E-02 Identities = 26/27 (96%), Gaps = 0/27 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGAT 27 ||||||||||||||||||||| ||||| Sbjct 155523 ATCGCTTCTCGGCCTTTTGGCCAAGAT 155497
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
155336
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
155526
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
4.85
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021127469.1

NW_021127469.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xfSc0000099, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 45.0 bits (41.9), Expect = 2.72E-01 Identities = 24/25 (96%), Gaps = 0/25 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 || |||||||||||||||||||||| Sbjct 107638 ATAGCTTCTCGGCCTTTTGGCTAAG 107614
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
107451
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
107633
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-2.6
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021127469.1

NW_021127469.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xfSc0000099, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 44.0 bits (41.0), Expect = 2.72E-01 Identities = 25/27 (93%), Gaps = 0/27 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGAT 27 ||||||||| ||||||||||| ||||| Sbjct 58908 ATCGCTTCTAGGCCTTTTGGCCAAGAT 58882
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
58721
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
58906
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-0.68
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021127469.1

NW_021127469.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xfSc0000099, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 42.0 bits (39.2), Expect = 9.49E-01 Identities = 26/28 (93%), Gaps = 1/28 (4%) Strand = Plus/Minus Query 11 GGCC-TTTTGGCTAAGATCAAGTGTAGT 37 |||| ||||||| ||||||||||||||| Sbjct 264 GGCCATTTTGGCCAAGATCAAGTGTAGT 237
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
86
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
275
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-5.26
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021127469.1

NW_021127469.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xfSc0000099, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 41.0 bits (38.3), Expect = 3.31E+00 Identities = 25/28 (89%), Gaps = 0/28 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATC 28 ||| |||| ||||||||||||| ||||| Sbjct 33812 ATCACTTCGCGGCCTTTTGGCTTAGATC 33785
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
33625
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
33815
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-6.38
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021127469.1

NW_021127469.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xfSc0000099, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 40.0 bits (37.4), Expect = 3.31E+00 Identities = 23/25 (92%), Gaps = 0/25 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 ||||||||||| ||||||| ||||| Sbjct 40840 ATCGCTTCTCGTCCTTTTGACTAAG 40816
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
40653
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
40838
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-13.2
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021127557.1

NW_021127557.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xfSc0000187, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 39388 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 39323 Query 67 CG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTG 131 || | ||| | | | |||||||||| |||||||||| | ||| ||||| || ||||| Sbjct 39322 CGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGGCTTG 39257 Query 132 CTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 | |||| ||||| | | | ||||| ||| ||||||| Sbjct 39256 CCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 39215
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
39200
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
39388
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021127557.1

NW_021127557.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xfSc0000187, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 48137 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 48072 Query 67 CG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTG 131 || | ||| | | | |||||||||| |||||||||| | ||| ||||| || ||||| Sbjct 48071 CGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGGCTTG 48006 Query 132 CTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 | |||| ||||| | | | ||||| ||| ||||||| Sbjct 48005 CCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 47964
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
47949
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
48137
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021127557.1

NW_021127557.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xfSc0000187, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 68.0 bits (62.6), Expect = 8.31E-08 Identities = 98/138 (71%), Gaps = 2/138 (1%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTT 104 ||||||||||||||| ||||||||||||| | | ||| | | | |||||||||| ||||||| Sbjct 3227 ATCTGTTCTTATCAGCTTAATATCTGATATGTTGCTCATTGAGCAGCTCATATATTAAACTGATTTTT 3160 Query 105 GG-AGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCT 171 || | |||| | || | | |||||| |||| ||||| | | | ||||| ||| ||||| Sbjct 3159 GGAACCAGGCTGTGAAAAAAAGGGCTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCT 3092 Query 172 CC 173 || Sbjct 3091 CC 3090
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
3071
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
3264
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
71.69
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021127557.1

NW_021127557.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xfSc0000187, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 45.0 bits (41.9), Expect = 2.72E-01 Identities = 24/25 (96%), Gaps = 0/25 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 ||||||||||||||||||||| ||| Sbjct 87314 ATCGCTTCTCGGCCTTTTGGCCAAG 87290
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
87127
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
87315
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-4.0
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_019218324.1

NW_019218324.1 Stylophora pistillata isolate CSM Monaco unplaced genomic scaffold, Stylophora pistillata v1 Spis.scaffold541, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct 6279 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATACG 6212 Query 69 -TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCT 135 | ||| | | | |||||||||| |||||||||| | ||| ||||| || |||||| Sbjct 6211 CTGCTCATTGAGTAGCTCATATATTAAACTGATTTTTGGAACTGGGCTGTGGAAAAGAGGCTTGCCTC 6144 Query 136 GTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 |||| ||||| | | | ||||| ||| ||||||| Sbjct 6143 GTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 6106
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
6091
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
6279
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
157.09
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_019218324.1

NW_019218324.1 Stylophora pistillata isolate CSM Monaco unplaced genomic scaffold, Stylophora pistillata v1 Spis.scaffold541, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 85.0 bits (77.9), Expect = 3.77E-12 Identities = 100/137 (73%), Gaps = 1/137 (1%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTT 104 |||| |||||||||| ||||||||||||||| | ||| | | | |||||||||| ||||||| Sbjct 6834 ATCTTTTCTTATCAGCTTAATATCTGATACGCTGCTCATTGAGTAGCTCATATATTAAACTGATTTTT 6767 Query 105 GGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTC 172 ||| | ||| ||||| || |||||| |||| ||||| | | | ||||| ||| |||||| Sbjct 6766 GGAACTGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTC 6699 Query 173 C 173 | Sbjct 6698 C 6698
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
6679
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
6871
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
93.83
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_019218324.1

NW_019218324.1 Stylophora pistillata isolate CSM Monaco unplaced genomic scaffold, Stylophora pistillata v1 Spis.scaffold541, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 66.0 bits (60.8), Expect = 2.90E-07 Identities = 33/33 (100%), Gaps = 0/33 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTG 33 ||||||||||||||||||||||||||||||||| Sbjct 4198 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTG 4166
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
4011
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
4184
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
21.86
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_019218324.1

NW_019218324.1 Stylophora pistillata isolate CSM Monaco unplaced genomic scaffold, Stylophora pistillata v1 Spis.scaffold541, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 49.0 bits (45.5), Expect = 2.23E-02 Identities = 28/29 (97%), Gaps = 1/29 (3%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCA 29 |||||||||||||||||||||| |||||| Sbjct 20536 ATCGCTTCTCGGCCTTTTGGCT-AGATCA 20509
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
20350
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
20534
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
2.14
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_019218324.1

NW_019218324.1 Stylophora pistillata isolate CSM Monaco unplaced genomic scaffold, Stylophora pistillata v1 Spis.scaffold541, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 42.0 bits (39.2), Expect = 9.49E-01 Identities = 26/28 (93%), Gaps = 1/28 (4%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATC 28 ||||||||| |||||||||||| ||||| Sbjct 14548 ATCGCTTCTTGGCCTTTTGGCT-AGATC 14522
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
14362
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
14558
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-0.26
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441080.1

NW_015441080.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970715.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 610775 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 610712 Query 65 TACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAG 127 |||| | ||| | | | |||||||||| |||||||||| | ||| ||||| || | Sbjct 610711 TACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGG 610648 Query 128 CTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||||| |||| ||||| | | | ||||| ||| ||||||| Sbjct 610647 CTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 610602
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
610587
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
610775
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441080.1

NW_015441080.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970715.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 612575 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 612512 Query 65 TACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAG 127 |||| | ||| | | | |||||||||| |||||||||| | ||| ||||| || | Sbjct 612511 TACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGG 612448 Query 128 CTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||||| |||| ||||| | | | ||||| ||| ||||||| Sbjct 612447 CTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 612402
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
612387
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
612575
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441080.1

NW_015441080.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970715.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 649451 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 649388 Query 65 TACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAG 127 |||| | ||| | | | |||||||||| |||||||||| | ||| ||||| || | Sbjct 649387 TACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGG 649324 Query 128 CTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||||| |||| ||||| | | | ||||| ||| ||||||| Sbjct 649323 CTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 649278
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
649263
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
649451
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441080.1

NW_015441080.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970715.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 681540 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 681477 Query 65 TACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAG 127 |||| | ||| | | | |||||||||| |||||||||| | ||| ||||| || | Sbjct 681476 TACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGG 681413 Query 128 CTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||||| |||| ||||| | | | ||||| ||| ||||||| Sbjct 681412 CTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 681367
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
681352
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
681540
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441080.1

NW_015441080.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970715.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 752278 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 752215 Query 65 TACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAG 127 |||| | ||| | | | |||||||||| |||||||||| | ||| ||||| || | Sbjct 752214 TACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGG 752151 Query 128 CTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||||| |||| ||||| | | | ||||| ||| ||||||| Sbjct 752150 CTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 752105
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
752090
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
752278
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441080.1

NW_015441080.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970715.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 149.0 bits (135.6), Expect = 1.60E-29 Identities = 135/174 (78%), Gaps = 1/174 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 633508 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 633445 Query 65 TACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAG 127 |||| | ||| | | | |||||||||| |||||||||| | ||| ||||| | | Sbjct 633444 TACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAATAGG 633381 Query 128 CTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||||| |||| |||| | | | ||||| ||| ||| ||| Sbjct 633380 CTTGCCTCGTCCCAGTCACGGGTTGCCTCGGTATAGCACTACTTCC 633335
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
633320
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
633508
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
150.0
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441080.1

NW_015441080.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970715.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 90.0 bits (82.4), Expect = 8.88E-14 Identities = 101/137 (74%), Gaps = 1/137 (1%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGAT 100 ||||||||||||||| ||||||||||||||| | ||| | | | |||||||||| ||| Sbjct 655556 ATCTGTTCTTATCAGCTTAATATCTGATACGCTGCTCATTGAGCAGCTCATATATTAAACTGAT 655493 Query 101 TTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGC 164 ||||||| | ||| ||||| || |||||| |||| ||||| | | | ||||| || Sbjct 655492 TTTTGGAACCGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGC 655429 Query 165 AGTACCTCC 173 | ||||||| Sbjct 655428 ACTACCTCC 655420
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
655408
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
655593
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
113.0
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441080.1

NW_015441080.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970715.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 83.0 bits (76.1), Expect = 1.32E-11 Identities = 99/136 (73%), Gaps = 1/136 (1%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGAT 100 ||||||||||||||| ||||||||||||| | | ||| | | | |||||||| | ||| Sbjct 670437 ATCTGTTCTTATCAGCTTAATATCTGATATGCTGCTCATTGAGCAGCTCATATATTACACTGAT 670374 Query 101 TTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGC 164 ||||||| | ||| ||||| || |||||| |||| ||||| | | | |||||| || Sbjct 670373 TTTTGGAACTGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGCCTTGGTATAGC 670310 Query 165 AGTACCTC 172 | |||||| Sbjct 670309 ACTACCTC 670302
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
670286
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
670474
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
90.04
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441080.1

NW_015441080.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970715.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 80.0 bits (73.4), Expect = 4.60E-11 Identities = 99/137 (72%), Gaps = 1/137 (1%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGAT 100 ||||||||||||||| ||||||||||||| | | ||| | | | |||||||||| ||| Sbjct 739187 ATCTGTTCTTATCAGCTTAATATCTGATATGCTGCTCATTGAGCAGCTCATATATTAAACTGAT 739124 Query 101 TTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGC 164 ||||||| | ||| ||||| || |||||| |||| |||| | | | ||||| || Sbjct 739123 TTTTGGAACCGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGTCACGGGTTGCCTCGGTATAGC 739060 Query 165 AGTACCTCC 173 | ||||||| Sbjct 739059 ACTACCTCC 739051
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
739037
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
739224
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
95.45
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441080.1

NW_015441080.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970715.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 80.0 bits (73.4), Expect = 4.60E-11 Identities = 99/137 (72%), Gaps = 1/137 (1%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGAT 100 ||||||||||||||| |||||||| |||| | | ||| | | | |||||||||| ||| Sbjct 757694 ATCTGTTCTTATCAGCTTAATATCCGATATGCTGCTCATTAAGCAGCTCATATATTAAACTGAT 757631 Query 101 TTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGC 164 ||||||| | ||| ||||| || |||||| |||| ||||| | | | ||||| || Sbjct 757630 TTTTGGAACCGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGAGTTGCCTCGGTATAGC 757567 Query 165 AGTACCTCC 173 | ||||||| Sbjct 757566 ACTACCTCC 757558
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
757544
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
757731
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
94.75
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441080.1

NW_015441080.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970715.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 75.0 bits (68.9), Expect = 1.96E-09 Identities = 98/137 (72%), Gaps = 1/137 (1%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGAT 100 ||| ||||||||||| ||||||||||||||| | ||| | | | ||||||| || ||| Sbjct 745053 ATCAGTTCTTATCAGCTTAATATCTGATACGCTGCTCATTGAGCAGCTCATATATTGAACTGAT 744990 Query 101 TTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGC 164 ||||||| | ||| ||||| || |||||| ||| ||||| | | | ||||| || Sbjct 744989 TTTTGGAACCGGGCTGTGGAAAAGAGGCTTGCCTCATCCCAGCCACGGGTTGCCTCGGTATAGC 744926 Query 165 AGTACCTCC 173 | ||||||| Sbjct 744925 ACTACCTCC 744917
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
744907
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
745090
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
93.54
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441080.1

NW_015441080.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970715.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 63.0 bits (58.1), Expect = 3.53E-06 Identities = 33/34 (97%), Gaps = 0/34 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGT 34 ||||||||||||||||||||||||||||||| || Sbjct 731538 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGAGT 731505
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
731351
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
731530
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
12.9
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441080.1

NW_015441080.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970715.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 52.0 bits (48.2), Expect = 1.83E-03 Identities = 26/26 (100%), Gaps = 0/26 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGA 26 |||||||||||||||||||||||||| Sbjct 657050 ATCGCTTCTCGGCCTTTTGGCTAAGA 657025
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
656863
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
657050
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
6.85
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441080.1

NW_015441080.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970715.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 51.0 bits (47.3), Expect = 6.39E-03 Identities = 27/28 (96%), Gaps = 0/28 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATC 28 ||||||||||||||||||||| |||||| Sbjct 653789 ATCGCTTCTCGGCCTTTTGGCCAAGATC 653762
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
653602
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
653783
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-3.18
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441080.1

NW_015441080.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970715.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 45.0 bits (41.9), Expect = 2.72E-01 Identities = 24/25 (96%), Gaps = 0/25 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 ||||||||||||||||||||| ||| Sbjct 638222 ATCGCTTCTCGGCCTTTTGGCCAAG 638246
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
638222
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
638408
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-9.83
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441080.1

NW_015441080.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970715.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 45.0 bits (41.9), Expect = 2.72E-01 Identities = 24/25 (96%), Gaps = 0/25 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 ||||||||||||||||||||| ||| Sbjct 642777 ATCGCTTCTCGGCCTTTTGGCCAAG 642753
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
642590
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
642788
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-9.19
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441080.1

NW_015441080.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970715.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 45.0 bits (41.9), Expect = 2.72E-01 Identities = 24/25 (96%), Gaps = 0/25 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 |||||||||||||||||| |||||| Sbjct 675387 ATCGCTTCTCGGCCTTTTTGCTAAG 675363
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
675200
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
675393
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-14.57
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441080.1

NW_015441080.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970715.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 44.0 bits (41.0), Expect = 2.72E-01 Identities = 25/27 (93%), Gaps = 0/27 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGAT 27 |||||||||||||||| |||| ||||| Sbjct 696570 ATCGCTTCTCGGCCTTCTGGCCAAGAT 696544
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
696383
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
696568
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-4.68
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441080.1

NW_015441080.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970715.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 44.0 bits (41.0), Expect = 2.72E-01 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCT 22 |||||||||||||||||||||| Sbjct 749897 ATCGCTTCTCGGCCTTTTGGCT 749876
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
749710
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
749888
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
8.94
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441080.1

NW_015441080.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970715.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 40.0 bits (37.4), Expect = 3.31E+00 Identities = 23/25 (92%), Gaps = 0/25 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 |||||||||||||||||| ||| || Sbjct 763903 ATCGCTTCTCGGCCTTTTAGCTTAG 763879
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
763716
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
763897
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-2.16
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441095.1

NW_015441095.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970730.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 184113 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 184050 Query 65 TACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAG 127 |||| | ||| | | | |||||||||| |||||||||| | ||| ||||| || | Sbjct 184049 TACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGG 183986 Query 128 CTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||||| |||| ||||| | | | ||||| ||| ||||||| Sbjct 183985 CTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 183940
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
183925
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
184113
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441095.1

NW_015441095.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970730.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 131.0 bits (119.4), Expect = 1.23E-24 Identities = 67/68 (99%), Gaps = 0/68 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 226413 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 226476 Query 65 TACG 68 |||| Sbjct 226477 TACG 226480
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
226413
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
226601
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
57.51
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441095.1

NW_015441095.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970730.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 83.0 bits (76.1), Expect = 1.32E-11 Identities = 99/136 (73%), Gaps = 1/136 (1%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGAT 100 ||||||||||||||| ||||||||||||||| | ||| | | | |||||||||| ||| Sbjct 172323 ATCTGTTCTTATCAGCTTAATATCTGATACGCTGCTCATTGAGCAGCTCATATATTAAACTGAT 172260 Query 101 TTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGC 164 ||||||| | || ||||| || |||||| |||| ||||| | | | ||||| || Sbjct 172259 TTTTGGAACCAGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGC 172196 Query 165 AGTACCTC 172 | |||||| Sbjct 172195 ACTACCTC 172188
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
172171
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
172360
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
94.9
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441095.1

NW_015441095.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970730.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 79.0 bits (72.5), Expect = 1.60E-10 Identities = 105/145 (72%), Gaps = 4/145 (3%) Strand = Plus/Plus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGAT 100 ||||||||||||||| ||||||||||||||| | || | | | |||||||||| ||| Sbjct 224586 ATCTGTTCTTATCAGCTTAATATCTGATACGCTGTTCATTGAGCAGCTCATATATTAAACTGAT 224649 Query 101 TTTTGGAGCAGGGAGATGG-AATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTG 163 ||||||| | ||| ||| || || |||||| |||| ||||| | | | ||||| | Sbjct 224650 TTTTGGAACCGGGCTGTGGCAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAG 224713 Query 164 CAGTACCTCCAGGACCG 180 || ||||||| ||||| Sbjct 224714 CACTACCTCC--GACCG 224728
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
224549
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
224738
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
91.44
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441095.1

NW_015441095.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970730.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 68.0 bits (62.6), Expect = 8.31E-08 Identities = 34/34 (100%), Gaps = 0/34 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGT 34 |||||||||||||||||||||||||||||||||| Sbjct 204118 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGT 204085
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
203931
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
204130
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
20.13
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441095.1

NW_015441095.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970730.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 45.0 bits (41.9), Expect = 2.72E-01 Identities = 24/25 (96%), Gaps = 0/25 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 ||||||||||||||||||||| ||| Sbjct 182313 ATCGCTTCTCGGCCTTTTGGCCAAG 182289
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
182126
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
182302
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-8.16
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441095.1

NW_015441095.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970730.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 41.0 bits (38.3), Expect = 3.31E+00 Identities = 27/30 (90%), Gaps = 1/30 (3%) Strand = Plus/Plus Query 6 TTCTCGGCCTTTTGGCTAAGAT-CAAGTGT 34 |||||||||||||||||||| | ||| ||| Sbjct 222981 TTCTCGGCCTTTTGGCTAAGTTGCAATTGT 223010
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
222976
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
223159
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-1.83
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441189.1

NW_015441189.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970824.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 20729 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 20664 Query 67 CG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTG 131 || | ||| | | | |||||||||| |||||||||| | ||| ||||| || ||||| Sbjct 20663 CGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGGCTTG 20598 Query 132 CTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 | |||| ||||| | | | ||||| ||| ||||||| Sbjct 20597 CCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 20556
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
20541
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
20729
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441189.1

NW_015441189.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970824.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 68374 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 68309 Query 67 CG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTG 131 || | ||| | | | |||||||||| |||||||||| | ||| ||||| || ||||| Sbjct 68308 CGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGGCTTG 68243 Query 132 CTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 | |||| ||||| | | | ||||| ||| ||||||| Sbjct 68242 CCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 68201
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
68186
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
68374
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441189.1

NW_015441189.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970824.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 162.0 bits (147.4), Expect = 2.54E-33 Identities = 137/173 (79%), Gaps = 1/173 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 18925 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 18860 Query 67 CG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTG 131 || | ||| | | | |||||||||| |||||||||| | ||| ||||| || ||||| Sbjct 18859 CGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGGCTTG 18794 Query 132 CTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTC 172 | |||| ||||| | | | ||||| ||| |||||| Sbjct 18793 CCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTC 18753
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
18737
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
18925
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
158.07
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441189.1

NW_015441189.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970824.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 80.0 bits (73.4), Expect = 4.60E-11 Identities = 99/137 (72%), Gaps = 1/137 (1%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGATTT 102 ||| ||||||||||| ||||||||||||||| | ||| | | | ||||||| || ||||| Sbjct 73719 ATCAGTTCTTATCAGCTTAATATCTGATACGCTGCTCATTGAGCAGCTCATATATTGAACTGATTT 73654 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTA 168 ||||| | ||| ||||| || |||||| |||| ||||| | | | ||||| ||| || Sbjct 73653 TTGGAACCGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTA 73588 Query 169 CCTCC 173 ||||| Sbjct 73587 CCTCC 73583
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
73568
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
73756
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
106.81
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441189.1

NW_015441189.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970824.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 45.0 bits (41.9), Expect = 2.72E-01 Identities = 24/25 (96%), Gaps = 0/25 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 ||||||||||||||||||| ||||| Sbjct 67133 ATCGCTTCTCGGCCTTTTGACTAAG 67109
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
66946
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
67134
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-12.78
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441189.1

NW_015441189.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970824.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 44.0 bits (41.0), Expect = 2.72E-01 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCT 22 |||||||||||||||||||||| Sbjct 78458 ATCGCTTCTCGGCCTTTTGGCT 78437
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
78271
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
78449
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
8.94
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441189.1

NW_015441189.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970824.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 43.0 bits (40.1), Expect = 9.49E-01 Identities = 23/24 (96%), Gaps = 0/24 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAA 24 ||||||||| |||||||||||||| Sbjct 15159 ATCGCTTCTTGGCCTTTTGGCTAA 15136
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
14972
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
15165
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-8.53
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441189.1

NW_015441189.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970824.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 40.0 bits (37.4), Expect = 3.31E+00 Identities = 23/25 (92%), Gaps = 0/25 (0%) Strand = Plus/Minus Query 4 GCTTCTCGGCCTTTTGGCTAAGATC 28 |||||||||||||||| ||||| || Sbjct 49781 GCTTCTCGGCCTTTTGACTAAGGTC 49757
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
49597
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
49774
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-8.73
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441241.1

NW_015441241.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970876.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 198650 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 198713 Query 65 TACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAG 127 |||| | ||| | | | |||||||||| |||||||||| | ||| ||||| || | Sbjct 198714 TACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGG 198777 Query 128 CTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||||| |||| ||||| | | | ||||| ||| ||||||| Sbjct 198778 CTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 198823
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
198650
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
198838
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441241.1

NW_015441241.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970876.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 45.0 bits (41.9), Expect = 2.72E-01 Identities = 24/25 (96%), Gaps = 0/25 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 |||||||||||| |||||||||||| Sbjct 200454 ATCGCTTCTCGGTCTTTTGGCTAAG 200478
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
200454
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
200639
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-4.4
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441245.1

NW_015441245.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970880.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 528036 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 528099 Query 65 TACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAG 127 |||| | ||| | | | |||||||||| |||||||||| | ||| ||||| || | Sbjct 528100 TACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGG 528163 Query 128 CTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||||| |||| ||||| | | | ||||| ||| ||||||| Sbjct 528164 CTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 528209
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
528036
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
528224
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441245.1

NW_015441245.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970880.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 98.0 bits (89.7), Expect = 5.98E-16 Identities = 49/49 (100%), Gaps = 0/49 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 489386 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 489434
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
489386
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
489575
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
25.67
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441245.1

NW_015441245.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970880.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 58.0 bits (53.6), Expect = 4.31E-05 Identities = 32/34 (94%), Gaps = 0/34 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGT 34 ||||||||||||| |||||||||||||| ||||| Sbjct 479680 ATCGCTTCTCGGCGTTTTGGCTAAGATCCAGTGT 479713
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
479680
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
479879
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
10.34
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441245.1

NW_015441245.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970880.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 56.0 bits (51.8), Expect = 1.50E-04 Identities = 28/28 (100%), Gaps = 0/28 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATC 28 |||||||||||||||||||||||||||| Sbjct 529722 ATCGCTTCTCGGCCTTTTGGCTAAGATC 529749
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
529722
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
529902
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
0.07
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441245.1

NW_015441245.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970880.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 53.0 bits (49.1), Expect = 1.83E-03 Identities = 69/96 (72%), Gaps = 1/96 (1%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGAT 100 || |||||||||||| ||| ||||| ||||| | ||| | | || ||| | |||| ||| Sbjct 542211 ATATGTTCTTATCAGCTTAGTATCTAATACGCTGCTCATTGAGTGGCTCATAAAATAAACTGAT 542148 Query 101 TTTTGGAGCAGGGAGATGGAATAGGAGCTTGC 132 ||||||| | || ||||| || |||||| Sbjct 542147 TTTTGGATCCGGCCTGTGGAAAAGAGGCTTGC 542116
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
542058
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
542248
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
53.81
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441251.1

NW_015441251.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970886.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 212995 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 212932 Query 65 TACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAG 127 |||| | ||| | | | |||||||||| |||||||||| | ||| ||||| || | Sbjct 212931 TACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGG 212868 Query 128 CTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||||| |||| ||||| | | | ||||| ||| ||||||| Sbjct 212867 CTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 212822
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
212807
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
212995
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441251.1

NW_015441251.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970886.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 332752 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 332689 Query 65 TACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAG 127 |||| | ||| | | | |||||||||| |||||||||| | ||| ||||| || | Sbjct 332688 TACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGG 332625 Query 128 CTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||||| |||| ||||| | | | ||||| ||| ||||||| Sbjct 332624 CTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 332579
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
332564
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
332752
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441251.1

NW_015441251.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970886.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 343240 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 343177 Query 65 TACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAG 127 |||| | ||| | | | |||||||||| |||||||||| | ||| ||||| || | Sbjct 343176 TACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGG 343113 Query 128 CTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||||| |||| ||||| | | | ||||| ||| ||||||| Sbjct 343112 CTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 343067
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
343052
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
343240
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441251.1

NW_015441251.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970886.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 345052 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 344989 Query 65 TACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAG 127 |||| | ||| | | | |||||||||| |||||||||| | ||| ||||| || | Sbjct 344988 TACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGG 344925 Query 128 CTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||||| |||| ||||| | | | ||||| ||| ||||||| Sbjct 344924 CTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 344879
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
344864
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
345052
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441251.1

NW_015441251.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970886.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 364241 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 364178 Query 65 TACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAG 127 |||| | ||| | | | |||||||||| |||||||||| | ||| ||||| || | Sbjct 364177 TACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGG 364114 Query 128 CTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||||| |||| ||||| | | | ||||| ||| ||||||| Sbjct 364113 CTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 364068
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
364053
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
364241
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441251.1

NW_015441251.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970886.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 367794 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 367731 Query 65 TACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAG 127 |||| | ||| | | | |||||||||| |||||||||| | ||| ||||| || | Sbjct 367730 TACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGG 367667 Query 128 CTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||||| |||| ||||| | | | ||||| ||| ||||||| Sbjct 367666 CTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 367621
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
367606
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
367794
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441251.1

NW_015441251.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970886.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 162.0 bits (147.4), Expect = 2.54E-33 Identities = 137/173 (79%), Gaps = 1/173 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 275519 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 275456 Query 65 TACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAG 127 |||| | ||| | | | |||||||||| |||||||||| | ||| ||||| || | Sbjct 275455 TACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGG 275392 Query 128 CTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTC 172 ||||| |||| ||||| | | | ||||| ||| |||||| Sbjct 275391 CTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTC 275347
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
275331
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
275520
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
126.61
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441251.1

NW_015441251.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970886.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 90.0 bits (82.4), Expect = 8.88E-14 Identities = 101/137 (74%), Gaps = 1/137 (1%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGAT 100 ||||||||||||||| ||||||||||||||| | ||| | | | |||||||||| ||| Sbjct 369557 ATCTGTTCTTATCAGCTTAATATCTGATACGCTGCTCATTGAGCAGCTCATATATTAAACTGAT 369494 Query 101 TTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGC 164 ||||||| | ||| ||||| || |||||| |||| ||||| | | | ||||| || Sbjct 369493 TTTTGGAACCGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGC 369430 Query 165 AGTACCTCC 173 | ||||||| Sbjct 369429 ACTACCTCC 369421
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
369405
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
369594
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
104.26
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441251.1

NW_015441251.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970886.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 87.0 bits (79.7), Expect = 1.08E-12 Identities = 103/140 (74%), Gaps = 7/140 (5%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG----TCCTCTATCCGAGGACAATATATTAAATG 97 ||||||||||||||| ||||||||||||| | || | ||| || | |||||||||| Sbjct 255537 ATCTGTTCTTATCAGCTTAATATCTGATATGGTTCTCATTGATC--AGCTC-ATATATTAAACT 255477 Query 98 GATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTAT 161 |||||||||| | ||| ||||| || |||||| ||||| ||||| | | | ||||| Sbjct 255476 GATTTTTGGAACCGGGCTGTGGAAAAGAGGCTTGCCTTGTCCCAGCCACGGGTTGCCTCGGTAT 255413 Query 162 TGCAGTACCTCC 173 ||| ||||||| Sbjct 255412 AGCACTACCTCC 255401
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
255384
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
255574
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
90.88
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441251.1

NW_015441251.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970886.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 80.0 bits (73.4), Expect = 4.60E-11 Identities = 99/137 (72%), Gaps = 1/137 (1%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGAT 100 |||| |||||||||| ||||||||||||||| | ||| | | | |||||||||| ||| Sbjct 279007 ATCTTTTCTTATCAGCTTAATATCTGATACGCTACTCATTGAGCAGCTCATATATTAAACTGAT 278944 Query 101 TTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGC 164 ||||||| | ||| ||||| || |||||| ||| ||||| | | | ||||| || Sbjct 278943 TTTTGGAACCGGGCTGTGGAAAAGAGGCTTGCCTCATCCCAGCCACGGGTTGCCTCGGTATAGC 278880 Query 165 AGTACCTCC 173 | ||||||| Sbjct 278879 ACTACCTCC 278871
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
278853
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
279044
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
84.07
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441251.1

NW_015441251.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970886.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 67.0 bits (61.7), Expect = 2.90E-07 Identities = 67/88 (76%), Gaps = 1/88 (1%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATAC-GTCCTCTATCCGAGGACAATATATTAAATGGAT 100 ||||||||||||||| |||||||||||||| | ||| | | | |||||||||| ||| Sbjct 221174 ATCTGTTCTTATCAGCTTAATATCTGATACACTGCTCATTGAGCAGCTCATATATTAAACTGAT 221111 Query 101 TTTTGGAGCAGGGAGATGGAATAG 124 ||||||| | ||| ||||| || Sbjct 221110 TTTTGGAACCGGGCTGTGGAAAAG 221087
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
221024
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
221211
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
20.37
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Ambiguous base detected in uid:100|NW_015441251.1rc, violating base NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN, pos 128

Hit: NW_015441251.1

NW_015441251.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970886.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 50.0 bits (46.4), Expect = 6.39E-03 Identities = 25/25 (100%), Gaps = 0/25 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 ||||||||||||||||||||||||| Sbjct 341226 ATCGCTTCTCGGCCTTTTGGCTAAG 341202
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
341039
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
341227
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-5.53
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441251.1

NW_015441251.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970886.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 50.0 bits (46.4), Expect = 6.39E-03 Identities = 25/25 (100%), Gaps = 0/25 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 ||||||||||||||||||||||||| Sbjct 356503 ATCGCTTCTCGGCCTTTTGGCTAAG 356479
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
356316
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
356497
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-1.31
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441251.1

NW_015441251.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970886.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 49.0 bits (45.5), Expect = 2.23E-02 Identities = 26/27 (96%), Gaps = 0/27 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGAT 27 ||||||||||||||||||||| ||||| Sbjct 299121 ATCGCTTCTCGGCCTTTTGGCCAAGAT 299095
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
298934
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
299136
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
2.07
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441251.1

NW_015441251.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970886.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 49.0 bits (45.5), Expect = 2.23E-02 Identities = 26/27 (96%), Gaps = 0/27 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGAT 27 ||||||||||||||||||||| ||||| Sbjct 350909 ATCGCTTCTCGGCCTTTTGGCCAAGAT 350883
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
350722
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
350921
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-0.92
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441251.1

NW_015441251.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970886.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 46.0 bits (42.8), Expect = 7.79E-02 Identities = 26/28 (93%), Gaps = 0/28 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATC 28 ||||||||||||||||||||| ||| || Sbjct 340135 ATCGCTTCTCGGCCTTTTGGCGAAGCTC 340108
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
339948
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
340137
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-15.05
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441251.1

NW_015441251.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970886.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 45.0 bits (41.9), Expect = 2.72E-01 Identities = 24/25 (96%), Gaps = 0/25 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 |||||||||||||||||||||| || Sbjct 315293 ATCGCTTCTCGGCCTTTTGGCTGAG 315269
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
315106
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
315292
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-4.91
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441251.1

NW_015441251.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970886.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 44.0 bits (41.0), Expect = 2.72E-01 Identities = 25/27 (93%), Gaps = 0/27 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGAT 27 ||| ||||||||||||||||| ||||| Sbjct 224436 ATCACTTCTCGGCCTTTTGGCCAAGAT 224410
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
224249
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
224423
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
2.58
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441251.1

NW_015441251.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970886.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 41.0 bits (38.3), Expect = 3.31E+00 Identities = 25/28 (89%), Gaps = 0/28 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATC 28 |||||||||| | |||||||||||| || Sbjct 207350 ATCGCTTCTCAGTCTTTTGGCTAAGTTC 207323
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
207163
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
207358
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-4.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441251.1

NW_015441251.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970886.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 41.0 bits (38.3), Expect = 3.31E+00 Identities = 22/23 (96%), Gaps = 0/23 (0%) Strand = Plus/Minus Query 7 TCTCGGCCTTTTGGCTAAGATCA 29 |||||||||||||||||||| || Sbjct 374762 TCTCGGCCTTTTGGCTAAGACCA 374740
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
374581
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
374768
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-1.1
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441307.1

NW_015441307.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970942.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 94677 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 94742 Query 67 CG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTG 131 || | ||| | | | |||||||||| |||||||||| | ||| ||||| || ||||| Sbjct 94743 CGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGGCTTG 94808 Query 132 CTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 | |||| ||||| | | | ||||| ||| ||||||| Sbjct 94809 CCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 94850
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
94677
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
94865
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441307.1

NW_015441307.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970942.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 159.0 bits (144.7), Expect = 3.10E-32 Identities = 137/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 139545 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 139608 Query 65 TACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAG 127 |||| | ||| | | | |||||||||| |||||||||| | ||| ||||| || | Sbjct 139609 TACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGG 139672 Query 128 CTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||||| |||| ||||| | | ||||| ||| ||||||| Sbjct 139673 CTTGCCTCGTCCCAGCCACGGGGTGCCTCGGTATAGCACTACCTCC 139718
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
139545
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
139733
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
155.01
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441307.1

NW_015441307.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970942.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 90.0 bits (82.4), Expect = 8.88E-14 Identities = 101/137 (74%), Gaps = 1/137 (1%) Strand = Plus/Plus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGATTT 102 ||||||||||||||| ||||||||||||||| | ||| | | | |||||||||| ||||| Sbjct 92914 ATCTGTTCTTATCAGCTTAATATCTGATACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTT 92979 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTA 168 ||||| | ||| ||||| || |||||| |||| ||||| | | | ||||| ||| || Sbjct 92980 TTGGAACCGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTA 93045 Query 169 CCTCC 173 ||||| Sbjct 93046 CCTCC 93050
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
92878
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
93065
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
106.06
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441307.1

NW_015441307.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970942.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 90.0 bits (82.4), Expect = 8.88E-14 Identities = 101/137 (74%), Gaps = 1/137 (1%) Strand = Plus/Plus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGAT 100 ||||||||||||||| ||||||||||||||| | ||| | | | |||||||||| ||| Sbjct 143843 ATCTGTTCTTATCAGCTTAATATCTGATACGCTGCTCATTGAGCAGCTCATATATTAAACTGAT 143906 Query 101 TTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGC 164 ||||||| | ||| ||||| ||| |||||| |||| ||| | | | | ||||| || Sbjct 143907 TTTTGGAACCGGGCTGTGGAAAAGGGGCTTGCCTCGTCCCAGCCATGGGTTGCCTCGGTATAGC 143970 Query 165 AGTACCTCC 173 | ||||||| Sbjct 143971 ACTACCTCC 143979
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
143809
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
143994
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
88.24
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441307.1

NW_015441307.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970942.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 66.0 bits (60.8), Expect = 2.90E-07 Identities = 100/140 (71%), Gaps = 6/140 (4%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACGTCCT-CTATCCGAG--GACAATATATTAAATGGAT 100 ||||||| |||||||||||||||||||| || || || | ||| | |||||||||| || Sbjct 42124 ATCTGTTGTTATCAGTTTAATATCTGAT--GTGCTGCTCACTGAGCAGCTCATATATTAAAGTGA- 42062 Query 101 TTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAG 166 |||||| | ||| | ||||| || |||||| || |||| | | | |||||| ||| Sbjct 42061 TTTTGGTACCGGGCGTTGGAAAAGAGGCTTGCCTCATCTCAGCCACAGGTTGCCTTGGTATAGCAC 41996 Query 167 TACCTCCA 174 |||||||| Sbjct 41995 TACCTCCA 41988
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
41975
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
42161
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
62.39
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441307.1

NW_015441307.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970942.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 45.0 bits (41.9), Expect = 2.72E-01 Identities = 24/25 (96%), Gaps = 0/25 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 ||||||||||| ||||||||||||| Sbjct 106765 ATCGCTTCTCGCCCTTTTGGCTAAG 106789
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
106765
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
106965
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-11.66
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441307.1

NW_015441307.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970942.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 40.0 bits (37.4), Expect = 3.31E+00 Identities = 20/20 (100%), Gaps = 0/20 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGG 20 |||||||||||||||||||| Sbjct 123107 ATCGCTTCTCGGCCTTTTGG 123126
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
123107
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
123294
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-23.68
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Ambiguous base detected in uid:116|NW_015441307.1fw, violating base NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN, pos 20

Hit: NW_015441504.1

NW_015441504.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971139.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 301194 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 301131 Query 65 TACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAG 127 |||| | ||| | | | |||||||||| |||||||||| | ||| ||||| || | Sbjct 301130 TACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGG 301067 Query 128 CTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||||| |||| ||||| | | | ||||| ||| ||||||| Sbjct 301066 CTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 301021
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
301006
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
301194
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
159.23
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441504.1

NW_015441504.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971139.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 45.0 bits (41.9), Expect = 2.72E-01 Identities = 24/25 (96%), Gaps = 0/25 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 |||||||||||||||||||||| || Sbjct 329233 ATCGCTTCTCGGCCTTTTGGCTGAG 329209
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
329046
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
329226
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-7.8
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441504.1

NW_015441504.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971139.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 41.0 bits (38.3), Expect = 3.31E+00 Identities = 25/28 (89%), Gaps = 0/28 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATC 28 || |||||||||||||||||| ||| || Sbjct 297953 ATTGCTTCTCGGCCTTTTGGCGAAGCTC 297926
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
297766
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
297958
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-14.31
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441534.1

NW_015441534.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971169.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 138343 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 138280 Query 65 TACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAG 127 |||| | ||| | | | |||||||||| |||||||||| | ||| ||||| || | Sbjct 138279 TACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGG 138216 Query 128 CTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||||| |||| ||||| | | | ||||| ||| ||||||| Sbjct 138215 CTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 138170
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
138155
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
138343
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441534.1

NW_015441534.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971169.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 85.0 bits (77.9), Expect = 3.77E-12 Identities = 100/137 (73%), Gaps = 1/137 (1%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGAT 100 ||||||||||||||| ||||||||||||||| | ||| | | | |||||||||| ||| Sbjct 146028 ATCTGTTCTTATCAGCTTAATATCTGATACGCTGCTCATTGAGCAGCTCATATATTAAACTGAT 145965 Query 101 TTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGC 164 ||||||| | ||| ||||| || |||||| ||| ||||| | | | ||||| || Sbjct 145964 TTTTGGAACCGGGCTGTGGAAAAGAGGCTTGCCTCATCCCAGCCACGGGTTGCCTCGGTATAGC 145901 Query 165 AGTACCTCC 173 | ||||||| Sbjct 145900 ACTACCTCC 145892
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
145881
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
146065
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
99.71
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441534.1

NW_015441534.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971169.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 45.0 bits (41.9), Expect = 2.72E-01 Identities = 24/25 (96%), Gaps = 0/25 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 |||||||||||| |||||||||||| Sbjct 136586 ATCGCTTCTCGGTCTTTTGGCTAAG 136562
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
136399
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
136582
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-3.21
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015442007.1

NW_015442007.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971642.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 55217 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 55152 Query 67 CG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTG 131 || | ||| | | | |||||||||| |||||||||| | ||| ||||| || ||||| Sbjct 55151 CGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGGCTTG 55086 Query 132 CTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 | |||| ||||| | | | ||||| ||| ||||||| Sbjct 55085 CCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 55044
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
55029
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
55217
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015442007.1

NW_015442007.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971642.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 57029 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 56964 Query 67 CG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTG 131 || | ||| | | | |||||||||| |||||||||| | ||| ||||| || ||||| Sbjct 56963 CGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGGCTTG 56898 Query 132 CTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 | |||| ||||| | | | ||||| ||| ||||||| Sbjct 56897 CCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 56856
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
56841
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
57029
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015442007.1

NW_015442007.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971642.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 58841 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 58776 Query 67 CG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTG 131 || | ||| | | | |||||||||| |||||||||| | ||| ||||| || ||||| Sbjct 58775 CGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGGCTTG 58710 Query 132 CTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 | |||| ||||| | | | ||||| ||| ||||||| Sbjct 58709 CCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 58668
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
58653
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
58841
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015442007.1

NW_015442007.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971642.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 60653 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 60588 Query 67 CG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTG 131 || | ||| | | | |||||||||| |||||||||| | ||| ||||| || ||||| Sbjct 60587 CGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGGCTTG 60522 Query 132 CTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 | |||| ||||| | | | ||||| ||| ||||||| Sbjct 60521 CCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 60480
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
60465
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
60653
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015442007.1

NW_015442007.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971642.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 62465 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 62400 Query 67 CG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTG 131 || | ||| | | | |||||||||| |||||||||| | ||| ||||| || ||||| Sbjct 62399 CGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGGCTTG 62334 Query 132 CTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 | |||| ||||| | | | ||||| ||| ||||||| Sbjct 62333 CCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 62292
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
62277
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
62465
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015442007.1

NW_015442007.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971642.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 64277 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 64212 Query 67 CG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTG 131 || | ||| | | | |||||||||| |||||||||| | ||| ||||| || ||||| Sbjct 64211 CGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGGCTTG 64146 Query 132 CTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 | |||| ||||| | | | ||||| ||| ||||||| Sbjct 64145 CCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 64104
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
64089
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
64277
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015442007.1

NW_015442007.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971642.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 147.0 bits (133.8), Expect = 5.60E-29 Identities = 110/133 (83%), Gaps = 1/133 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 53405 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 53340 Query 67 CG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTG 131 || | ||| | | | |||||||||| |||||||||| | ||| ||||| || | ||| Sbjct 53339 CGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGGGTTG 53274 Query 132 C 132 | Sbjct 53273 C 53273
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
53217
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
53405
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
89.5
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015442007.1

NW_015442007.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971642.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 47.0 bits (43.7), Expect = 7.79E-02 Identities = 51/68 (75%), Gaps = 1/68 (1%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGATTT 102 ||||||||||||||| | |||||||||| | ||||| | | | |||||||| | ||||| Sbjct 98006 ATCTGTTCTTATCAGCTCAATATCTGATCTGCTCCTCATTGAGCAGCTCATATATTACACTGATTT 97941 Query 103 TT 104 || Sbjct 97940 TT 97939
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
97855
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
98041
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-19.44
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015442007.1

NW_015442007.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971642.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 43.0 bits (40.1), Expect = 9.49E-01 Identities = 23/24 (96%), Gaps = 0/24 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAA 24 ||||||||| |||||||||||||| Sbjct 50663 ATCGCTTCTTGGCCTTTTGGCTAA 50640
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
50476
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
50667
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-10.29
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015442007.1

NW_015442007.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971642.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 41.0 bits (38.3), Expect = 3.31E+00 Identities = 25/28 (89%), Gaps = 0/28 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATC 28 |||||||||||||||||||| ||| || Sbjct 102681 ATCGCTTCTCGGCCTTTTGGTGAAGCTC 102654
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
102494
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
102698
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-17.65
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015442206.1

NW_015442206.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971841.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 17482 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 17547 Query 67 CG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTG 131 || | ||| | | | |||||||||| |||||||||| | ||| ||||| || ||||| Sbjct 17548 CGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGGCTTG 17613 Query 132 CTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 | |||| ||||| | | | ||||| ||| ||||||| Sbjct 17614 CCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 17655
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
17482
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
17670
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015442206.1

NW_015442206.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971841.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 58212 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 58147 Query 67 CG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTG 131 || | ||| | | | |||||||||| |||||||||| | ||| ||||| || ||||| Sbjct 58146 CGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGGCTTG 58081 Query 132 CTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 | |||| ||||| | | | ||||| ||| ||||||| Sbjct 58080 CCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 58039
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
58024
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
58212
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015442206.1

NW_015442206.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971841.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 164.0 bits (149.2), Expect = 7.28E-34 Identities = 138/174 (79%), Gaps = 1/174 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 61777 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 61712 Query 67 CG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTG 131 || | ||| | | | |||||||||| |||||||||| | ||| ||||| || ||||| Sbjct 61711 CGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGGCTTG 61646 Query 132 CTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 | |||| ||||| | | | ||||| ||| ||||||| Sbjct 61645 CCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 61604
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
61589
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
61777
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
161.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015442206.1

NW_015442206.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971841.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 85.0 bits (77.9), Expect = 3.77E-12 Identities = 100/137 (73%), Gaps = 1/137 (1%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGATTT 102 |||||||||||| || ||||||||||||||| | ||| | | | |||||||||| ||||| Sbjct 31958 ATCTGTTCTTATTAGCTTAATATCTGATACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTT 31893 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTA 168 ||||| | ||| ||||| || |||||| |||| ||||| | | | ||||| ||| || Sbjct 31892 TTGGAACCGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTA 31827 Query 169 CCTCC 173 ||||| Sbjct 31826 CCTCC 31822
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
31805
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
31995
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
102.23
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015442206.1

NW_015442206.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971841.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 80.0 bits (73.4), Expect = 4.60E-11 Identities = 99/137 (72%), Gaps = 1/137 (1%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGATTT 102 ||||||||||||||| |||| |||||||||| | ||| | | | |||||||||| ||||| Sbjct 38598 ATCTGTTCTTATCAGCTTAAGATCTGATACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTT 38533 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTA 168 ||||| | ||| ||||| || |||||| ||| ||||| | | | ||||| ||| || Sbjct 38532 TTGGAACCGGGCTGTGGAAAAGAGGCTTGCCTCATCCCAGCCACGGGTTGCCTCGGTATAGCACTA 38467 Query 169 CCTCC 173 ||||| Sbjct 38466 CCTCC 38462
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
38446
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
38635
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
93.75
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015442206.1

NW_015442206.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971841.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 53.0 bits (49.1), Expect = 1.83E-03 Identities = 28/29 (97%), Gaps = 0/29 (0%) Strand = Plus/Minus Query 40 CTGTTCTTATCAGTTTAATATCTGATACG 68 ||||||||||||| ||||||||||||||| Sbjct 28681 CTGTTCTTATCAGCTTAATATCTGATACG 28653
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
28531
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
28712
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-19.2
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015442206.1

NW_015442206.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971841.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 52.0 bits (48.2), Expect = 1.83E-03 Identities = 26/26 (100%), Gaps = 0/26 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGA 26 |||||||||||||||||||||||||| Sbjct 59778 ATCGCTTCTCGGCCTTTTGGCTAAGA 59753
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
59591
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
59778
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
5.94
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015442206.1

NW_015442206.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971841.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 46.0 bits (42.8), Expect = 7.79E-02 Identities = 23/23 (100%), Gaps = 0/23 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTA 23 ||||||||||||||||||||||| Sbjct 30186 ATCGCTTCTCGGCCTTTTGGCTA 30164
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
29999
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
30176
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
3.83
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015442206.1

NW_015442206.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971841.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 46.0 bits (42.8), Expect = 7.79E-02 Identities = 26/28 (93%), Gaps = 0/28 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATC 28 ||||||||||||||||||| ||||| || Sbjct 43504 ATCGCTTCTCGGCCTTTTGCCTAAGGTC 43477
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
43317
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
43505
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-6.18
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015442206.1

NW_015442206.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971841.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 44.0 bits (41.0), Expect = 2.72E-01 Identities = 25/27 (93%), Gaps = 0/27 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGAT 27 ||||||||||||||||||||| |||| Sbjct 36857 ATCGCTTCTCGGCCTTTTGGCCGAGAT 36831
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
36670
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
36856
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-5.0
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_001834208.1

NW_001834208.1 Nematostella vectensis NEMVEscaffold_206 genomic scaffold, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 162.0 bits (147.4), Expect = 2.54E-33 Identities = 139/175 (79%), Gaps = 2/175 (1%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 213405 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 213468 Query 65 TACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAAT-AGGA 126 |||| | ||| | | | |||||||||| |||||||||| || |||||| || Sbjct 213469 TACGCTGCTCATTGAGTAGCTCATATATTAAACTGATTTTTGGAAACTGGCTGTGGAATAAGCG 213532 Query 127 GCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||||||| |||| ||||| | | | ||||||||| ||||||| Sbjct 213533 GCTTGCTGCGTCCCAGCCACGGGTTGTCTCGGTATTGCACTACCTCC 213579
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
213405
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
213594
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
137.2
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_001834194.1

NW_001834194.1 Nematostella vectensis NEMVEscaffold_220 genomic scaffold, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 162.0 bits (147.4), Expect = 2.54E-33 Identities = 139/175 (79%), Gaps = 2/175 (1%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 374004 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 374067 Query 65 TACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAAT-AGGA 126 |||| | ||| | | | |||||||||| |||||||||| || |||||| || Sbjct 374068 TACGCTGCTCATTGAGTAGCTCATATATTAAACTGATTTTTGGAAACTGGCTGTGGAATAAGCG 374131 Query 127 GCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||||||| |||| ||||| | | | ||||||||| ||||||| Sbjct 374132 GCTTGCTGCGTCCCAGCCACGGGTTGTCTCGGTATTGCACTACCTCC 374178
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
374004
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
374193
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
137.2
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_001834194.1

NW_001834194.1 Nematostella vectensis NEMVEscaffold_220 genomic scaffold, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 162.0 bits (147.4), Expect = 2.54E-33 Identities = 139/175 (79%), Gaps = 2/175 (1%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 375708 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 375771 Query 65 TACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAAT-AGGA 126 |||| | ||| | | | |||||||||| |||||||||| || |||||| || Sbjct 375772 TACGCTGCTCATTGAGTAGCTCATATATTAAACTGATTTTTGGAAACTGGCTGTGGAATAAGCG 375835 Query 127 GCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||||||| |||| ||||| | | | ||||||||| ||||||| Sbjct 375836 GCTTGCTGCGTCCCAGCCACGGGTTGTCTCGGTATTGCACTACCTCC 375882
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
375708
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
375897
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
137.2
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_001833685.1

NW_001833685.1 Nematostella vectensis NEMVEscaffold_729 genomic scaffold, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 162.0 bits (147.4), Expect = 2.54E-33 Identities = 139/175 (79%), Gaps = 2/175 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 14119 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 14054 Query 67 CG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAAT-AGGAGCTT 130 || | ||| | | | |||||||||| |||||||||| || |||||| || |||| Sbjct 14053 CGCTGCTCATTGAGTAGCTCATATATTAAACTGATTTTTGGAAACTGGCTGTGGAATAAGCGGCTT 13988 Query 131 GCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||| |||| ||||| | | | ||||||||| ||||||| Sbjct 13987 GCTGCGTCCCAGCCACGGGTTGTCTCGGTATTGCACTACCTCC 13945
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
13930
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
14119
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
137.2
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_001833685.1

NW_001833685.1 Nematostella vectensis NEMVEscaffold_729 genomic scaffold, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 162.0 bits (147.4), Expect = 2.54E-33 Identities = 139/175 (79%), Gaps = 2/175 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 19675 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 19610 Query 67 CG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAAT-AGGAGCTT 130 || | ||| | | | |||||||||| |||||||||| || |||||| || |||| Sbjct 19609 CGCTGCTCATTGAGTAGCTCATATATTAAACTGATTTTTGGAAACTGGCTGTGGAATAAGCGGCTT 19544 Query 131 GCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||| |||| ||||| | | | ||||||||| ||||||| Sbjct 19543 GCTGCGTCCCAGCCACGGGTTGTCTCGGTATTGCACTACCTCC 19501
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
19486
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
19675
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
137.2
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_001831544.1

NW_001831544.1 Nematostella vectensis NEMVEscaffold_2994 genomic scaffold, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 162.0 bits (147.4), Expect = 2.54E-33 Identities = 139/175 (79%), Gaps = 2/175 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct 4919 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATACG 4852 Query 69 -TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAAT-AGGAGCTTGCTC 134 | ||| | | | |||||||||| |||||||||| || |||||| || ||||||| Sbjct 4851 CTGCTCATTGAGTAGCTCATATATTAAACTGATTTTTGGAAACTGGCTGTGGAATAAGCGGCTTGCTG 4784 Query 135 TGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 |||| ||||| | | | ||||||||| ||||||| Sbjct 4783 CGTCCCAGCCACGGGTTGTCTCGGTATTGCACTACCTCC 4745
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
4730
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
4919
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
137.2
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_001831544.1

NW_001831544.1 Nematostella vectensis NEMVEscaffold_2994 genomic scaffold, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 162.0 bits (147.4), Expect = 2.54E-33 Identities = 139/175 (79%), Gaps = 2/175 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct 8587 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATACG 8520 Query 69 -TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAAT-AGGAGCTTGCTC 134 | ||| | | | |||||||||| |||||||||| || |||||| || ||||||| Sbjct 8519 CTGCTCATTGAGTAGCTCATATATTAAACTGATTTTTGGAAACTGGCTGTGGAATAAGCGGCTTGCTG 8452 Query 135 TGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 |||| ||||| | | | ||||||||| ||||||| Sbjct 8451 CGTCCCAGCCACGGGTTGTCTCGGTATTGCACTACCTCC 8413
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
8398
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
8587
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
137.2
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_001831544.1

NW_001831544.1 Nematostella vectensis NEMVEscaffold_2994 genomic scaffold, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 142.0 bits (129.3), Expect = 6.82E-28 Identities = 94/108 (87%), Gaps = 1/108 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-T 69 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | Sbjct 136 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATACGCT 67 Query 70 CCTCTATCCGAGGACAATATATTAAATGGATTTTTGGA 107 ||| | | | |||||||||| |||||||||| Sbjct 66 GCTCATTGAGTAGCTCATATATTAAACTGATTTTTGGA 29
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
31
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
166
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
75.94
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

NW_001831544.1: Sequence cannot be extended sufficiently. Missing -82 nt upstream in the genome.
NW_001831544.1: Sequence cannot be extended sufficiently by unaligned portion of query. THIS IS PROBABLY FRAGMENT! Trimmed upstream.

Hit: NW_001831544.1

NW_001831544.1 Nematostella vectensis NEMVEscaffold_2994 genomic scaffold, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 142.0 bits (129.3), Expect = 6.82E-28 Identities = 135/174 (78%), Gaps = 4/174 (2%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct 1832 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATACG 1765 Query 69 -TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCT 135 | ||| | | | |||||||||| || ||||| | | || | |||||| | | |||| Sbjct 1764 CTGCTCATTGAGTAGCTCATATATTAAACTGA-TTTTGAAACTGGCTG--GGAATAAGCGGCTGCTGC 1700 Query 136 GTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 || | ||||| | | | ||||||||| ||||||| Sbjct 1699 GTTCCAGCCACGGGTTGTCTCGGTATTGCACTACCTCC 1662
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
1647
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1832
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
121.9
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_001828443.1

NW_001828443.1 Nematostella vectensis NEMVEscaffold_6614 genomic scaffold, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 162.0 bits (147.4), Expect = 2.54E-33 Identities = 139/175 (79%), Gaps = 2/175 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct 6479 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATACG 6412 Query 69 -TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAAT-AGGAGCTTGCTC 134 | ||| | | | |||||||||| |||||||||| || |||||| || ||||||| Sbjct 6411 CTGCTCATTGAGTAGCTCATATATTAAACTGATTTTTGGAAACTGGCTGTGGAATAAGCGGCTTGCTG 6344 Query 135 TGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 |||| ||||| | | | ||||||||| ||||||| Sbjct 6343 CGTCCCAGCCACGGGTTGTCTCGGTATTGCACTACCTCC 6305
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
6290
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
6479
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
137.2
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_001828443.1

NW_001828443.1 Nematostella vectensis NEMVEscaffold_6614 genomic scaffold, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 161.0 bits (146.5), Expect = 8.87E-33 Identities = 139/176 (79%), Gaps = 3/176 (2%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-T 69 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | Sbjct 233 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATACGCT 164 Query 70 CCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGA--GCTTGCTCTGT 137 ||| | | | |||||||||| |||||||||| || ||||||| | ||||||| || Sbjct 163 GCTCATTGAGTAGCTCATATATTAAACTGATTTTTGGAAACTGGCTGTGGAATAAGNCGGCTTGCTGCGT 94 Query 138 CCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 || ||||| | | | ||||||||| ||||||| Sbjct 93 CCCAGCCACGGGTTGTCTCGGTATTGCACTACCTCC 58
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
43
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
233
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
129.43
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Ambiguous base detected in uid:153|NW_001828443.1rc, violating base N, pos 126

Hit: NW_001834366.1

NW_001834366.1 Nematostella vectensis NEMVEscaffold_48 genomic scaffold, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 162.0 bits (147.4), Expect = 2.54E-33 Identities = 139/175 (79%), Gaps = 2/175 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCT 62 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct 1092055 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCT 1091994 Query 63 GATACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAAT- 122 |||||| | ||| | | | |||||||||| |||||||||| || |||||| Sbjct 1091993 GATACGCTGCTCATTGAGTAGCTCATATATTAAACTGATTTTTGGAAACTGGCTGTGGAATA 1091932 Query 123 AGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 || ||||||| |||| ||||| | | | ||||||||| ||||||| Sbjct 1091931 AGCGGCTTGCTGCGTCCCAGCCACGGGTTGTCTCGGTATTGCACTACCTCC 1091881
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
1091866
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1092055
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
137.2
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_001834366.1

NW_001834366.1 Nematostella vectensis NEMVEscaffold_48 genomic scaffold, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 100.0 bits (91.5), Expect = 1.71E-16 Identities = 50/50 (100%), Gaps = 0/50 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATC 50 |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1102218 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATC 1102169
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
1102031
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1102215
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
38.58
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_001834366.1

NW_001834366.1 Nematostella vectensis NEMVEscaffold_48 genomic scaffold, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 96.0 bits (87.8), Expect = 2.09E-15 Identities = 48/48 (100%), Gaps = 0/48 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTA 48 |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1124176 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTA 1124129
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
1123989
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1124185
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
34.08
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_001834366.1

NW_001834366.1 Nematostella vectensis NEMVEscaffold_48 genomic scaffold, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 94.0 bits (86.0), Expect = 7.29E-15 Identities = 105/141 (74%), Gaps = 2/141 (1%) Strand = Plus/Minus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAA 95 |||||||||||||||||| ||||||||||||||| | ||| | | | |||||||||| Sbjct 1095964 AGTATCTGTTCTTATCAGCTTAATATCTGATACGCTGCTCATTGAGTAGCTCATATATTAAA 1095903 Query 96 TGGATTTTTGGAGCAGGGAGATGGAAT-AGGAGCTTGCTCTGTCCACTCCACGCATCGACCT 156 |||||||||| || |||||| || ||||||| |||| ||||| | | | Sbjct 1095902 CTGATTTTTGGAAACTGGCTGTGGAATAAGCGGCTTGCTGCGTCCCAGCCACGGGTTGTCTC 1095841 Query 157 GGTATTGCAGTACCTCC 173 ||||||||| ||||||| Sbjct 1095840 GGTATTGCACTACCTCC 1095824
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
1095809
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1095998
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
80.12
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_001827341.1

NW_001827341.1 Nematostella vectensis NEMVEscaffold_8096 genomic scaffold, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 149.0 bits (135.6), Expect = 1.60E-29 Identities = 131/166 (79%), Gaps = 2/166 (1%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct 3446 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATACG 3513 Query 69 -TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAAT-AGGAGCTTGCTC 134 | ||| | | | |||||||||| |||||||||| || |||||| || ||||||| Sbjct 3514 CTGCTCATTGAGTAGCTCATATATTAAACTGATTTTTGGAAACTGGCTGTGGAATAAGCGGCTTGCTG 3581 Query 135 TGTCCACTCCACGCATCGACCTGGTATTGC 164 |||| ||||| | | | |||||||| Sbjct 3582 CGTCCCAGCCACGGGTTGTCTCGGTATTGC 3611
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
3446
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
3611
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
93.3
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

NW_001827341.1: Sequence cannot be extended sufficiently by unalined portion of query. THIS IS PROBABLY FRAGMENT! Trimmed downstream.
NW_001827341.1: Sequence cannot be extended sufficiently. Missing nt downstream in the genome.

Hit: NW_001834408.1

NW_001834408.1 Nematostella vectensis NEMVEscaffold_6 genomic scaffold, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 145.0 bits (132.0), Expect = 1.95E-28 Identities = 120/149 (81%), Gaps = 2/149 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCT 62 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct 1620146 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCT 1620085 Query 63 GATACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAAT- 122 |||||| | ||| | | | |||||||||| |||||||||| || |||||| Sbjct 1620084 GATACGCTGCTCATTGAGTAGCTCATATATTAAACTGATTTTTGGAAACTGGCTGTGGAATA 1620023 Query 123 AGGAGCTTGCTCTGTCCACTCCACG 147 || ||||||| |||| ||||| Sbjct 1620022 AGCGGCTTGCTGCGTCCCAGCCACG 1619998
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
1619957
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1620150
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
89.79
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441114.1

NW_015441114.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970749.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 145.0 bits (132.0), Expect = 1.95E-28 Identities = 133/172 (77%), Gaps = 1/172 (1%) Strand = Plus/Minus Query 4 GCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATAC 67 ||||||||| ||||||||||||||||||||||| |||||||||||||| |||||||||||||| Sbjct 832251 GCTTCTCGGTTTTTTGGCTAAGATCAAGTGTAGTGTCTGTTCTTATCAGCTTAATATCTGATAC 832188 Query 68 G-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTT 130 | | ||| | | | |||||||||| |||||||||| | ||| ||||| || |||| Sbjct 832187 GCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGGCTT 832124 Query 131 GCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCCA 174 || |||| ||||| | | | ||||| ||| |||||||| Sbjct 832123 GCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCCA 832080
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
832066
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
832254
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
136.72
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441114.1

NW_015441114.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF970749.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 95.0 bits (86.9), Expect = 7.29E-15 Identities = 111/152 (73%), Gaps = 1/152 (1%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGAT 100 ||||||||||||||| ||||||||||||||| | ||| | | | |||||||||| ||| Sbjct 847022 ATCTGTTCTTATCAGCTTAATATCTGATACGCTGCTCATTGAGCAGCTCATATATTAAACTGAT 846959 Query 101 TTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGC 164 ||||||| | ||| ||||| || |||||| |||| ||||| | | | ||||| || Sbjct 846958 TTTTGGAACCGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGC 846895 Query 165 AGTACCTCCAGGACCGGTGCACTT 188 | |||||||| | ||| ||||| Sbjct 846894 ACTACCTCCAAGCGCGGCCCACTT 846871
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
846868
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
847059
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
96.8
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441851.1

NW_015441851.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971486.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 145.0 bits (132.0), Expect = 1.95E-28 Identities = 103/122 (84%), Gaps = 1/122 (1%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 64817 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 64882 Query 67 CG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAA 121 || | ||| | | | |||||||||| |||||||||| | ||| ||||| Sbjct 64883 CGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTTGGAACCGGGCTGTGGAA 64938
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
64817
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
65003
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
84.88
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441851.1

NW_015441851.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971486.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 131.0 bits (119.4), Expect = 1.23E-24 Identities = 67/68 (99%), Gaps = 0/68 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 105170 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 105107 Query 65 TACG 68 |||| Sbjct 105106 TACG 105103
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
104983
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
105165
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
44.55
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441851.1

NW_015441851.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971486.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 90.0 bits (82.4), Expect = 8.88E-14 Identities = 101/137 (74%), Gaps = 1/137 (1%) Strand = Plus/Plus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGATTT 102 ||||||||||||||| ||||||||||||||| | ||| | | | |||||||||| ||||| Sbjct 87077 ATCTGTTCTTATCAGCTTAATATCTGATACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTT 87142 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTA 168 ||||| | ||| ||||| || |||||| |||| ||||| | | | ||||| ||| || Sbjct 87143 TTGGAACCGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTA 87208 Query 169 CCTCC 173 ||||| Sbjct 87209 CCTCC 87213
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
87041
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
87228
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
112.25
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441851.1

NW_015441851.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971486.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 90.0 bits (82.4), Expect = 8.88E-14 Identities = 101/137 (74%), Gaps = 1/137 (1%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGATTT 102 ||||||||||||||| ||||||||||||||| | ||| | | | |||||||||| ||||| Sbjct 95125 ATCTGTTCTTATCAGCTTAATATCTGATACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTT 95060 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTA 168 ||||| | ||| ||||| || |||||| |||| ||||| | | | ||||| ||| || Sbjct 95059 TTGGAACCGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTA 94994 Query 169 CCTCC 173 ||||| Sbjct 94993 CCTCC 94989
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
94972
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
95162
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
103.43
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441851.1

NW_015441851.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971486.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 85.0 bits (77.9), Expect = 3.77E-12 Identities = 100/137 (73%), Gaps = 1/137 (1%) Strand = Plus/Plus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGATTT 102 ||||||||||||||| ||||||||||||||| | ||| | | | |||||||||| ||||| Sbjct 73470 ATCTGTTCTTATCAGCTTAATATCTGATACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTT 73535 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTA 168 ||||| | ||| ||||| || |||||| |||| ||||| | | ||||| ||| || Sbjct 73536 TTGGAACCGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGGGGTGCCTCGGTATAGCACTA 73601 Query 169 CCTCC 173 ||||| Sbjct 73602 CCTCC 73606
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
73433
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
73621
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
99.98
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441851.1

NW_015441851.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971486.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 54.0 bits (50.0), Expect = 5.25E-04 Identities = 30/32 (94%), Gaps = 0/32 (0%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACGT 69 || |||||||||||| |||||||||||||||| Sbjct 41692 ATATGTTCTTATCAGCTTAATATCTGATACGT 41661
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
41542
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
41729
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-13.49
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441851.1

NW_015441851.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971486.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 50.0 bits (46.4), Expect = 6.39E-03 Identities = 25/25 (100%), Gaps = 0/25 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 ||||||||||||||||||||||||| Sbjct 93148 ATCGCTTCTCGGCCTTTTGGCTAAG 93124
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
92961
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
93155
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-0.25
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441851.1

NW_015441851.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971486.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 50.0 bits (46.4), Expect = 6.39E-03 Identities = 25/25 (100%), Gaps = 0/25 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 ||||||||||||||||||||||||| Sbjct 100060 ATCGCTTCTCGGCCTTTTGGCTAAG 100036
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
99873
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
100054
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-3.55
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441851.1

NW_015441851.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971486.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 50.0 bits (46.4), Expect = 6.39E-03 Identities = 25/25 (100%), Gaps = 0/25 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 ||||||||||||||||||||||||| Sbjct 117381 ATCGCTTCTCGGCCTTTTGGCTAAG 117357
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
117194
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
117380
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
2.7800000000000002
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_015441851.1

NW_015441851.1 Acropora digitifera unplaced genomic scaffold, Adig_1.1 DF971486.1, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 46.0 bits (42.8), Expect = 7.79E-02 Identities = 26/28 (93%), Gaps = 0/28 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATC 28 ||||||||||||||||||||| ||| || Sbjct 46781 ATCGCTTCTCGGCCTTTTGGCGAAGCTC 46754
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
46594
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
46776
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-12.47
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_001828013.1

NW_001828013.1 Nematostella vectensis NEMVEscaffold_7168 genomic scaffold, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 142.0 bits (129.3), Expect = 6.82E-28 Identities = 94/108 (87%), Gaps = 1/108 (1%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct 6136 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATACG 6203 Query 69 -TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGA 107 | ||| | | | |||||||||| |||||||||| Sbjct 6204 CTGCTCATTGAGTAGCTCATATATTAAACTGATTTTTGGA 6243
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
6136
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
6274
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
76.49
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

NW_001828013.1: Sequence cannot be extended sufficiently by unalined portion of query. THIS IS PROBABLY FRAGMENT! Trimmed downstream.
NW_001828013.1: Sequence cannot be extended sufficiently. Missing nt downstream in the genome.

Hit: NW_001825345.1

NW_001825345.1 Nematostella vectensis NEMVEscaffold_12326 genomic scaffold, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 142.0 bits (129.3), Expect = 6.82E-28 Identities = 94/108 (87%), Gaps = 1/108 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct 1133 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATACG 1066 Query 69 -TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGA 107 | ||| | | | |||||||||| |||||||||| Sbjct 1065 CTGCTCATTGAGTAGCTCATATATTAAACTGATTTTTGGA 1026
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
945
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1133
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
74.65
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 138.0 bits (125.7), Expect = 8.31E-27 Identities = 135/175 (77%), Gaps = 3/175 (2%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 111814 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 111751 Query 65 TACG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGA 126 || | | | || || | | |||||||||| ||||||||| || ||| || | | Sbjct 111750 TATGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAA 111688 Query 127 GCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||||||| | || ||||| | | | ||||||||| ||| ||| Sbjct 111687 GCTTGCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATCC 111641
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
111626
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
111814
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
136.06
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 138.0 bits (125.7), Expect = 8.31E-27 Identities = 135/175 (77%), Gaps = 3/175 (2%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 137366 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 137303 Query 65 TACG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGA 126 || | | | || || | | |||||||||| ||||||||| || ||| || | | Sbjct 137302 TATGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAA 137240 Query 127 GCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||||||| | || ||||| | | | ||||||||| ||| ||| Sbjct 137239 GCTTGCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATCC 137193
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
137178
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
137366
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
136.06
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 138.0 bits (125.7), Expect = 8.31E-27 Identities = 135/175 (77%), Gaps = 3/175 (2%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 149075 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 149012 Query 65 TACG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGA 126 || | | | || || | | |||||||||| ||||||||| || ||| || | | Sbjct 149011 TATGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAA 148949 Query 127 GCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||||||| | || ||||| | | | ||||||||| ||| ||| Sbjct 148948 GCTTGCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATCC 148902
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
148887
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
149075
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
136.06
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 138.0 bits (125.7), Expect = 8.31E-27 Identities = 135/175 (77%), Gaps = 3/175 (2%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 160790 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 160727 Query 65 TACG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGA 126 || | | | || || | | |||||||||| ||||||||| || ||| || | | Sbjct 160726 TATGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAA 160664 Query 127 GCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||||||| | || ||||| | | | ||||||||| ||| ||| Sbjct 160663 GCTTGCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATCC 160617
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
160602
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
160790
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
136.06
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 138.0 bits (125.7), Expect = 8.31E-27 Identities = 135/175 (77%), Gaps = 3/175 (2%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGA 64 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 169908 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGA 169845 Query 65 TACG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGA 126 || | | | || || | | |||||||||| ||||||||| || ||| || | | Sbjct 169844 TATGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAA 169782 Query 127 GCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||||||| | || ||||| | | | ||||||||| ||| ||| Sbjct 169781 GCTTGCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATCC 169735
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
169720
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
169908
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
136.06
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 96.0 bits (87.8), Expect = 2.09E-15 Identities = 114/154 (74%), Gaps = 3/154 (2%) Strand = Plus/Minus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGA 83 ||||||||||||||||||||||||||||||| ||||||||||||| | | | || || | Sbjct 162267 TAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACT 162204 Query 84 CAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACG 147 | |||||||||| ||||||||| || ||| || | |||||||| | || ||||| Sbjct 162203 C-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACG 162141 Query 148 CATCGACCTGGTATTGCAGTACCTCC 173 | | | ||||||||| ||| ||| Sbjct 162140 GGTTGTCTCGGTATTGCACTACATCC 162115
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
162098
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
162288
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
83.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 96.0 bits (87.8), Expect = 2.09E-15 Identities = 114/154 (74%), Gaps = 3/154 (2%) Strand = Plus/Minus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGA 83 ||||||||||||||||||||||||||||||| ||||||||||||| | | | || || | Sbjct 171355 TAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACT 171292 Query 84 CAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACG 147 | |||||||||| ||||||||| || ||| || | |||||||| | || ||||| Sbjct 171291 C-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACG 171229 Query 148 CATCGACCTGGTATTGCAGTACCTCC 173 | | | ||||||||| ||| ||| Sbjct 171228 GGTTGTCTCGGTATTGCACTACATCC 171203
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
171186
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
171376
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
83.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 96.0 bits (87.8), Expect = 2.09E-15 Identities = 114/154 (74%), Gaps = 3/154 (2%) Strand = Plus/Minus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGA 83 ||||||||||||||||||||||||||||||| ||||||||||||| | | | || || | Sbjct 179330 TAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACT 179267 Query 84 CAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACG 147 | |||||||||| ||||||||| || ||| || | | |||||| | || ||||| Sbjct 179266 C-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAACCTTGCTTCGCCCTGGCCACG 179204 Query 148 CATCGACCTGGTATTGCAGTACCTCC 173 | | | ||||||||||||| ||| Sbjct 179203 GGTTGTCTCGGTATTGCAGTACATCC 179178
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
179163
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
179351
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
74.18
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 96.0 bits (87.8), Expect = 2.09E-15 Identities = 114/154 (74%), Gaps = 3/154 (2%) Strand = Plus/Minus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGA 83 ||||||||||||||||||||||||||||||| ||||||||||||| | | | || || | Sbjct 202900 TAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACT 202837 Query 84 CAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACG 147 | |||||||||| ||||||||| || ||| || | |||||||| | || ||||| Sbjct 202836 C-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACG 202774 Query 148 CATCGACCTGGTATTGCAGTACCTCC 173 | | | ||||||||| ||| ||| Sbjct 202773 GGTTGTCTCGGTATTGCACTACATCC 202748
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
202731
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
202921
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
86.68
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 92.0 bits (84.2), Expect = 2.54E-14 Identities = 112/152 (74%), Gaps = 3/152 (2%) Strand = Plus/Minus Query 24 AGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACA 85 ||||||||||||||||||||||||||||| ||||||||||||| | | | || || | | Sbjct 126629 AGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC- 126567 Query 86 ATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCA 149 |||||||||| ||||||||| || ||| || | |||||||| | || ||||| Sbjct 126566 ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGG 126503 Query 150 TCGACCTGGTATTGCAGTACCTCC 173 | | | ||||||||| ||| ||| Sbjct 126502 TTGTCTCGGTATTGCACTACATCC 126479
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
126465
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
126652
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
94.35
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 92.0 bits (84.2), Expect = 2.54E-14 Identities = 112/152 (74%), Gaps = 3/152 (2%) Strand = Plus/Minus Query 24 AGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACA 85 ||||||||||||||||||||||||||||| ||||||||||||| | | | || || | | Sbjct 147223 AGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC- 147161 Query 86 ATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCA 149 |||||||||| ||||||||| || ||| || | |||||||| | || ||||| Sbjct 147160 ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGG 147097 Query 150 TCGACCTGGTATTGCAGTACCTCC 173 | | | ||||||||| ||| ||| Sbjct 147096 TTGTCTCGGTATTGCACTACATCC 147073
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
147058
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
147246
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
88.01
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 92.0 bits (84.2), Expect = 2.54E-14 Identities = 112/152 (74%), Gaps = 3/152 (2%) Strand = Plus/Minus Query 24 AGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACA 85 ||||||||||||||||||||||||||||| ||||||||||||| | | | || || | | Sbjct 150565 AGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC- 150503 Query 86 ATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCA 149 |||||||||| ||||||||| || ||| || | |||||||| | || ||||| Sbjct 150502 ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGG 150439 Query 150 TCGACCTGGTATTGCAGTACCTCC 173 | | | ||||||||| ||| ||| Sbjct 150438 TTGTCTCGGTATTGCACTACATCC 150415
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
150400
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
150588
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
87.84
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 92.0 bits (84.2), Expect = 2.54E-14 Identities = 112/152 (74%), Gaps = 3/152 (2%) Strand = Plus/Minus Query 24 AGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACA 85 ||||||||||||||||||||||||||||| ||||||||||||| | | | || || | | Sbjct 152397 AGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC- 152335 Query 86 ATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCA 149 |||||||||| ||||||||| || ||| || | |||||||| | || ||||| Sbjct 152334 ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGG 152271 Query 150 TCGACCTGGTATTGCAGTACCTCC 173 | | | ||||||||| ||| ||| Sbjct 152270 TTGTCTCGGTATTGCACTACATCC 152247
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
152232
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
152420
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
88.01
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 92.0 bits (84.2), Expect = 2.54E-14 Identities = 112/152 (74%), Gaps = 3/152 (2%) Strand = Plus/Minus Query 24 AGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACA 85 ||||||||||||||||||||||||||||| ||||||||||||| | | | || || | | Sbjct 210284 AGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC- 210222 Query 86 ATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCA 149 |||||||||| ||||||||| || ||| || | |||||||| | || ||||| Sbjct 210221 ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGG 210158 Query 150 TCGACCTGGTATTGCAGTACCTCC 173 | | | ||||||||| ||| ||| Sbjct 210157 TTGTCTCGGTATTGCACTACATCC 210134
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
210117
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
210307
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
83.24
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 89.0 bits (81.5), Expect = 3.10E-13 Identities = 109/148 (74%), Gaps = 3/148 (2%) Strand = Plus/Minus Query 24 AGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACA 85 ||||||||||||||||||||||||||||| ||||||||||||| | | | || || | | Sbjct 145394 AGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC- 145332 Query 86 ATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCA 149 |||||||||| ||||||||| || ||| || | |||||||| | || ||||| Sbjct 145331 ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGG 145268 Query 150 TCGACCTGGTATTGCAGTAC 169 | | | ||||||||| ||| Sbjct 145267 TTGTCTCGGTATTGCACTAC 145248
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
145229
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
145413
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
68.25
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 74.0 bits (68.0), Expect = 1.96E-09 Identities = 37/37 (100%), Gaps = 0/37 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGT 37 ||||||||||||||||||||||||||||||||||||| Sbjct 50682 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGT 50646
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
50495
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
50677
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
29.92
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 74.0 bits (68.0), Expect = 1.96E-09 Identities = 37/37 (100%), Gaps = 0/37 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGT 37 ||||||||||||||||||||||||||||||||||||| Sbjct 126970 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGT 126934
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
126783
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
126965
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
30.45
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 74.0 bits (68.0), Expect = 1.96E-09 Identities = 37/37 (100%), Gaps = 0/37 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGT 37 ||||||||||||||||||||||||||||||||||||| Sbjct 145734 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGT 145698
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
145547
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
145729
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
30.45
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 74.0 bits (68.0), Expect = 1.96E-09 Identities = 37/37 (100%), Gaps = 0/37 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGT 37 ||||||||||||||||||||||||||||||||||||| Sbjct 147564 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGT 147528
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
147377
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
147559
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
30.45
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 74.0 bits (68.0), Expect = 1.96E-09 Identities = 37/37 (100%), Gaps = 0/37 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGT 37 ||||||||||||||||||||||||||||||||||||| Sbjct 150906 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGT 150870
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
150719
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
150901
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
30.45
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 74.0 bits (68.0), Expect = 1.96E-09 Identities = 37/37 (100%), Gaps = 0/37 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGT 37 ||||||||||||||||||||||||||||||||||||| Sbjct 152738 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGT 152702
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
152551
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
152733
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
30.45
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 73.0 bits (67.1), Expect = 6.82E-09 Identities = 45/50 (90%), Gaps = 3/50 (6%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTA---GTATCTGTTCTT 47 ||||||||||||||||||||||||||||||||||| | || ||||||| Sbjct 110335 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGCCGCATTTGTTCTT 110286
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
110145
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
110347
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
26.05
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 73.0 bits (67.1), Expect = 6.82E-09 Identities = 45/50 (90%), Gaps = 3/50 (6%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTA---GTATCTGTTCTT 47 ||||||||||||||||||||||||||||||||||| | || ||||||| Sbjct 118650 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGCCGCATTTGTTCTT 118601
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
118460
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
118642
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
24.0
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 73.0 bits (67.1), Expect = 6.82E-09 Identities = 45/50 (90%), Gaps = 3/50 (6%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTA---GTATCTGTTCTT 47 ||||||||||||||||||||||||||||||||||| | || ||||||| Sbjct 125171 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGCCGCATTTGTTCTT 125122
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
124981
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
125183
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
26.05
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 73.0 bits (67.1), Expect = 6.82E-09 Identities = 45/50 (90%), Gaps = 3/50 (6%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTA---GTATCTGTTCTT 47 ||||||||||||||||||||||||||||||||||| | || ||||||| Sbjct 143949 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGCCGCATTTGTTCTT 143900
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
143759
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
143961
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
26.05
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 73.0 bits (67.1), Expect = 6.82E-09 Identities = 45/50 (90%), Gaps = 3/50 (6%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTA---GTATCTGTTCTT 47 ||||||||||||||||||||||||||||||||||| | || ||||||| Sbjct 159282 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGCCGCATTTGTTCTT 159233
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
159092
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
159294
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
26.05
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 72.0 bits (66.2), Expect = 6.82E-09 Identities = 36/36 (100%), Gaps = 0/36 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAG 36 |||||||||||||||||||||||||||||||||||| Sbjct 82095 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAG 82060
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
81908
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
82104
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
26.99
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 69.0 bits (63.5), Expect = 8.31E-08 Identities = 36/37 (97%), Gaps = 0/37 (0%) Strand = Plus/Minus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAAT 58 ||||||||||||||||||||||||||||||| ||||| Sbjct 38902 TAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAAT 38866
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
38734
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
38923
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-21.24
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 69.0 bits (63.5), Expect = 8.31E-08 Identities = 36/37 (97%), Gaps = 0/37 (0%) Strand = Plus/Minus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAAT 58 ||||||||||||||||||||||||||||||| ||||| Sbjct 68044 TAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAAT 68008
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
67878
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
68078
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-13.19
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 69.0 bits (63.5), Expect = 8.31E-08 Identities = 36/37 (97%), Gaps = 0/37 (0%) Strand = Plus/Minus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAAT 58 ||||||||||||||||||||||||||||||| ||||| Sbjct 186429 TAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAAT 186393
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
186261
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
186448
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-11.3
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 65.0 bits (59.9), Expect = 1.01E-06 Identities = 100/141 (71%), Gaps = 3/141 (2%) Strand = Plus/Minus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAATATATTAAATGG 98 || ||||||||||||||| ||||||||||||| | | | || || | | |||||||||| | Sbjct 14785 AGAATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-ATATATTAAACTG 14721 Query 99 ATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGC 164 |||||||| || ||| || | |||||||| | || ||||| | | | |||||||| Sbjct 14720 ATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGC 14655 Query 165 AGTACCTCC 173 | ||| ||| Sbjct 14654 ACTACATCC 14646
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
14633
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
14819
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
84.05
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 62.0 bits (57.2), Expect = 3.53E-06 Identities = 97/137 (71%), Gaps = 3/137 (2%) Strand = Plus/Minus Query 39 TCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAATATATTAAATGGAT 100 |||||||||||||| ||||||||||||| | | | || || | | |||||||||| ||| Sbjct 105191 TCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-ATATATTAAACTGAT 105129 Query 101 TTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGC 164 |||||| || ||| || | |||||||| | || ||||| | | | |||||||| Sbjct 105128 TTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGC 105065 Query 165 AGTACCTCC 173 | ||| ||| Sbjct 105064 ACTACATCC 105056
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
105038
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
105229
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
84.65
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 62.0 bits (57.2), Expect = 3.53E-06 Identities = 97/137 (71%), Gaps = 3/137 (2%) Strand = Plus/Minus Query 39 TCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAATATATTAAATGGAT 100 |||||||||||||| ||||||||||||| | | | || || | | |||||||||| ||| Sbjct 113258 TCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-ATATATTAAACTGAT 113196 Query 101 TTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGC 164 |||||| || ||| || | |||||||| | || ||||| | | | |||||||| Sbjct 113195 TTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGC 113132 Query 165 AGTACCTCC 173 | ||| ||| Sbjct 113131 ACTACATCC 113123
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
113105
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
113296
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
84.51
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 62.0 bits (57.2), Expect = 3.53E-06 Identities = 97/137 (71%), Gaps = 3/137 (2%) Strand = Plus/Minus Query 39 TCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAATATATTAAATGGAT 100 |||||||||||||| ||||||||||||| | | | || || | | |||||||||| ||| Sbjct 134598 TCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-ATATATTAAACTGAT 134536 Query 101 TTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGC 164 |||||| || ||| || | |||||||| | || ||||| | | | |||||||| Sbjct 134535 TTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGC 134472 Query 165 AGTACCTCC 173 | ||| ||| Sbjct 134471 ACTACATCC 134463
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
134450
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
134636
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
82.26
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 62.0 bits (57.2), Expect = 3.53E-06 Identities = 97/137 (71%), Gaps = 3/137 (2%) Strand = Plus/Minus Query 39 TCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAATATATTAAATGGAT 100 |||||||||||||| ||||||||||||| | | | || || | | |||||||||| ||| Sbjct 138809 TCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-ATATATTAAACTGAT 138747 Query 101 TTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGC 164 |||||| || ||| || | |||||||| | || ||||| | | | |||||||| Sbjct 138746 TTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGC 138683 Query 165 AGTACCTCC 173 | ||| ||| Sbjct 138682 ACTACATCC 138674
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
138656
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
138847
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
84.65
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 62.0 bits (57.2), Expect = 3.53E-06 Identities = 97/137 (71%), Gaps = 3/137 (2%) Strand = Plus/Minus Query 39 TCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAATATATTAAATGGAT 100 |||||||||||||| ||||||||||||| | | | || || | | |||||||||| ||| Sbjct 154210 TCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-ATATATTAAACTGAT 154148 Query 101 TTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGC 164 |||||| || ||| || | |||||||| | || ||||| | | | |||||||| Sbjct 154147 TTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGC 154084 Query 165 AGTACCTCC 173 | ||| ||| Sbjct 154083 ACTACATCC 154075
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
154057
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
154248
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
84.65
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 61.0 bits (56.3), Expect = 1.23E-05 Identities = 32/33 (97%), Gaps = 0/33 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTG 33 |||||||||||||||||||||||||||||| || Sbjct 168420 ATCGCTTCTCGGCCTTTTGGCTAAGATCAATTG 168388
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
168233
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
168424
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
14.39
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 60.0 bits (55.4), Expect = 1.23E-05 Identities = 96/136 (71%), Gaps = 3/136 (2%) Strand = Plus/Minus Query 39 TCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTT 102 |||||||||||||| ||||||||||||| | | | || || | | |||||||||| ||||| Sbjct 88679 TCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTT 88615 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTA 168 |||| || ||| || | |||||||| | || ||||| | | | ||||||||| || Sbjct 88614 TTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTA 88549 Query 169 CCTC 172 | || Sbjct 88548 CATC 88545
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
88526
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
88717
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
80.65
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 60.0 bits (55.4), Expect = 1.23E-05 Identities = 30/30 (100%), Gaps = 0/30 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAA 30 |||||||||||||||||||||||||||||| Sbjct 135888 ATCGCTTCTCGGCCTTTTGGCTAAGATCAA 135859
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
135701
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
135898
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
0.05
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 59.0 bits (54.5), Expect = 4.31E-05 Identities = 100/142 (70%), Gaps = 10/142 (7%) Strand = Plus/Minus Query 39 TCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTT 102 |||||||||||||| ||||||||||||| | | | || || | | |||||||||| ||||| Sbjct 34008 TCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTT 33944 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGCT-----CTGTCCACTCCACGCATCGACCTGGTATTG 163 |||| || ||| || | |||||||| ||| ||| ||||| | | | ||||||| Sbjct 33943 TTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCA--CCACGGGTTGTCTCGGTATTG 33880 Query 164 CAGTACCTCC 173 || ||| ||| Sbjct 33879 CACTACATCC 33870
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
33853
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
34046
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
74.53
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 57.0 bits (52.7), Expect = 1.50E-04 Identities = 96/137 (70%), Gaps = 3/137 (2%) Strand = Plus/Minus Query 39 TCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTT 102 |||||||||||||| ||||||||||||| | | | || || | | |||||||||| ||||| Sbjct 64331 TCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTT 64267 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTA 168 |||| || ||| || | |||||||| | || ||||| | | | |||||||| || Sbjct 64266 TTGGCCTTCGGCCTTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGTCTCAGTATTGCACTA 64201 Query 169 CCTCC 173 | ||| Sbjct 64200 CATCC 64196
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
64183
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
64369
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
82.85
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 57.0 bits (52.7), Expect = 1.50E-04 Identities = 99/139 (71%), Gaps = 9/139 (6%) Strand = Plus/Minus Query 39 TCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAATATATTAAATGGAT 100 |||||||||||||| ||||||||||||| | | | || || | | |||||||||| ||| Sbjct 120086 TCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-ATATATTAAACTGAT 120024 Query 101 TTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACT--CCACGCATCGACCTGGTATT 162 |||||| || ||| || | |||||||| ||| || ||||| | | | |||||| Sbjct 120023 TTTTGGCCTTCGGCCCTGG-ATTGAAGCTTGCT---TCCCCTGGCCACGGGTTGTCTCGGTATT 119964 Query 163 GCAGTACCTCC 173 ||| ||| ||| Sbjct 119963 GCACTACATCC 119953
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
119935
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
120124
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
72.73
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 54.0 bits (50.0), Expect = 5.25E-04 Identities = 27/27 (100%), Gaps = 0/27 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGAT 27 ||||||||||||||||||||||||||| Sbjct 32504 ATCGCTTCTCGGCCTTTTGGCTAAGAT 32478
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
32317
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
32504
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
1.51
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 52.0 bits (48.2), Expect = 1.83E-03 Identities = 26/26 (100%), Gaps = 0/26 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGA 26 |||||||||||||||||||||||||| Sbjct 103706 ATCGCTTCTCGGCCTTTTGGCTAAGA 103681
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
103519
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
103701
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
2.14
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 52.0 bits (48.2), Expect = 1.83E-03 Identities = 26/26 (100%), Gaps = 0/26 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGA 26 |||||||||||||||||||||||||| Sbjct 177853 ATCGCTTCTCGGCCTTTTGGCTAAGA 177828
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
177666
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
177855
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
1.56
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 50.0 bits (46.4), Expect = 6.39E-03 Identities = 25/25 (100%), Gaps = 0/25 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 ||||||||||||||||||||||||| Sbjct 208847 ATCGCTTCTCGGCCTTTTGGCTAAG 208823
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
208660
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
208843
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
3.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 48.0 bits (44.6), Expect = 2.23E-02 Identities = 24/24 (100%), Gaps = 0/24 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAA 24 |||||||||||||||||||||||| Sbjct 13329 ATCGCTTCTCGGCCTTTTGGCTAA 13306
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
13142
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
13329
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-10.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163260.1

NW_021163260.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000250F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 40.0 bits (37.4), Expect = 3.31E+00 Identities = 23/25 (92%), Gaps = 0/25 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 |||||||||||| ||||||||||| Sbjct 196088 ATCGCTTCTCGGTTTTTTGGCTAAG 196064
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
195901
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
196077
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-10.92
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 138.0 bits (125.7), Expect = 8.31E-27 Identities = 135/175 (77%), Gaps = 3/175 (2%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 15653 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 15718 Query 67 CG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTT 130 | | | || || | | |||||||||| ||||||||| || ||| || | ||||| Sbjct 15719 TGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTT 15783 Query 131 GCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||| | || ||||| | | | ||||||||| ||| ||| Sbjct 15784 GCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATCC 15826
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
15653
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
15841
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
136.06
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 138.0 bits (125.7), Expect = 8.31E-27 Identities = 135/175 (77%), Gaps = 3/175 (2%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 17135 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 17200 Query 67 CG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTT 130 | | | || || | | |||||||||| ||||||||| || ||| || | ||||| Sbjct 17201 TGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTT 17265 Query 131 GCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||| | || ||||| | | | ||||||||| ||| ||| Sbjct 17266 GCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATCC 17308
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
17135
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
17323
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
136.06
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 127.0 bits (115.8), Expect = 1.50E-23 Identities = 135/176 (77%), Gaps = 5/176 (3%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 ||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 54137 ATCGCTTCTCGGCCTTT-GGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 54201 Query 67 CG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGAT-GGAATAGGAGCT 129 | | | || || | | |||||||||| ||||||||| || | ||||| | |||| Sbjct 54202 TGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGAATTGAAGCT 54266 Query 130 TGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 |||| | || ||||| | | | ||||||||| ||| ||| Sbjct 54267 TGCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATCC 54310
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
54137
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
54325
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
124.24
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 113.0 bits (103.2), Expect = 9.48E-20 Identities = 58/59 (98%), Gaps = 0/59 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATA 59 |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Sbjct 2267 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATA 2325
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
2267
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
2453
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
39.61
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 113.0 bits (103.2), Expect = 9.48E-20 Identities = 58/59 (98%), Gaps = 0/59 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATA 59 |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Sbjct 18613 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATA 18671
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
18613
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
18799
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
39.61
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 96.0 bits (87.8), Expect = 2.09E-15 Identities = 114/154 (74%), Gaps = 3/154 (2%) Strand = Plus/Plus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACA 85 ||||||||||||||||||||||||||||||| ||||||||||||| | | | || || | | Sbjct 14184 TAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC- 14248 Query 86 ATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATC 151 |||||||||| ||||||||| || ||| || | |||||||| | || ||||| | Sbjct 14249 ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTT 14314 Query 152 GACCTGGTATTGCAGTACCTCC 173 | | ||||||||| ||| ||| Sbjct 14315 GTCTCGGTATTGCACTACATCC 14336
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
14161
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
14351
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
85.78
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 96.0 bits (87.8), Expect = 2.09E-15 Identities = 114/154 (74%), Gaps = 3/154 (2%) Strand = Plus/Plus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACA 85 ||||||||||||||||||||||||||||||| ||||||||||||| | | | || || | | Sbjct 31045 TAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC- 31109 Query 86 ATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATC 151 |||||||||| ||||||||| || ||| || | |||||||| | || ||||| | Sbjct 31110 ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTT 31175 Query 152 GACCTGGTATTGCAGTACCTCC 173 | | ||||||||| ||| ||| Sbjct 31176 GTCTCGGTATTGCACTACATCC 31197
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
31022
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
31212
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
83.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 96.0 bits (87.8), Expect = 2.09E-15 Identities = 114/154 (74%), Gaps = 3/154 (2%) Strand = Plus/Plus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACA 85 ||||||||||||||||||||||||||||||| ||||||||||||| | | | || || | | Sbjct 64135 TAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC- 64199 Query 86 ATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATC 151 |||||||||| ||||||||| || ||| || | |||||||| | || ||||| | Sbjct 64200 ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTT 64265 Query 152 GACCTGGTATTGCAGTACCTCC 173 | | ||||||||| ||| ||| Sbjct 64266 GTCTCGGTATTGCACTACATCC 64287
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
64115
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
64302
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
83.69
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 96.0 bits (87.8), Expect = 2.09E-15 Identities = 114/154 (74%), Gaps = 3/154 (2%) Strand = Plus/Plus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACA 85 ||||||||||||||||||||||||||||||| ||||||||||||| | | | || || | | Sbjct 67437 TAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC- 67501 Query 86 ATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATC 151 |||||||||| ||||||||| || ||| || | |||||||| | || ||||| | Sbjct 67502 ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTT 67567 Query 152 GACCTGGTATTGCAGTACCTCC 173 | | ||||||||| ||| ||| Sbjct 67568 GTCTCGGTATTGCACTACATCC 67589
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
67416
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
67604
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
83.13
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 96.0 bits (87.8), Expect = 2.09E-15 Identities = 114/154 (74%), Gaps = 3/154 (2%) Strand = Plus/Plus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACA 85 ||||||||||||||||||||||||||||||| ||||||||||||| | | | || || | | Sbjct 82643 TAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC- 82707 Query 86 ATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATC 151 |||||||||| ||||||||| || ||| || | |||||||| | || ||||| | Sbjct 82708 ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTT 82773 Query 152 GACCTGGTATTGCAGTACCTCC 173 | | ||||||||| ||| ||| Sbjct 82774 GTCTCGGTATTGCACTACATCC 82795
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
82620
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
82810
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
83.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 96.0 bits (87.8), Expect = 2.09E-15 Identities = 114/154 (74%), Gaps = 3/154 (2%) Strand = Plus/Plus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACA 85 ||||||||||||||||||||||||||||||| ||||||||||||| | | | || || | | Sbjct 89900 TAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC- 89964 Query 86 ATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATC 151 |||||||||| ||||||||| || ||| || | |||||||| | || ||||| | Sbjct 89965 ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTT 90030 Query 152 GACCTGGTATTGCAGTACCTCC 173 | | ||||||||| ||| ||| Sbjct 90031 GTCTCGGTATTGCACTACATCC 90052
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
89877
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
90067
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
84.65
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 96.0 bits (87.8), Expect = 2.09E-15 Identities = 114/154 (74%), Gaps = 3/154 (2%) Strand = Plus/Plus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGA 83 ||||||||||||||||||||||||||||||| ||||||||||||| | | | || || | Sbjct 110182 TAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACT 110245 Query 84 CAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACG 147 | |||||||||| ||||||||| || ||| || | |||||||| | || ||||| Sbjct 110246 C-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACG 110308 Query 148 CATCGACCTGGTATTGCAGTACCTCC 173 | | | ||||||||| ||| ||| Sbjct 110309 GGTTGTCTCGGTATTGCACTACATCC 110334
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
110159
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
110349
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
83.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 96.0 bits (87.8), Expect = 2.09E-15 Identities = 114/154 (74%), Gaps = 3/154 (2%) Strand = Plus/Plus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGA 83 ||||||||||||||||||||||||||||||| ||||||||||||| | | | || || | Sbjct 123794 TAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACT 123857 Query 84 CAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACG 147 | |||||||||| ||||||||| || ||| || | |||||||| | || ||||| Sbjct 123858 C-ATATATTAAACTGATTTTTGGCCTTCGGTCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACG 123920 Query 148 CATCGACCTGGTATTGCAGTACCTCC 173 | | | ||||||||| ||| ||| Sbjct 123921 GGTTGTCTCGGTATTGCACTACATCC 123946
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
123771
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
123961
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
88.2
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 92.0 bits (84.2), Expect = 2.54E-14 Identities = 112/152 (74%), Gaps = 3/152 (2%) Strand = Plus/Plus Query 24 AGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAAT 87 ||||||||||||||||||||||||||||| ||||||||||||| | | | || || | | || Sbjct 75191 AGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-AT 75255 Query 88 ATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGA 153 |||||||| ||||||||| || ||| || | |||||||| | || ||||| | | Sbjct 75256 ATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGT 75321 Query 154 CCTGGTATTGCAGTACCTCC 173 | ||||||||| ||| ||| Sbjct 75322 CTCGGTATTGCACTACATCC 75341
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
75168
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
75356
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
88.01
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 74.0 bits (68.0), Expect = 1.96E-09 Identities = 37/37 (100%), Gaps = 0/37 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGT 37 ||||||||||||||||||||||||||||||||||||| Sbjct 32502 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGT 32538
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
32502
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
32684
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
30.45
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 73.0 bits (67.1), Expect = 6.82E-09 Identities = 45/50 (90%), Gaps = 3/50 (6%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTA---GTATCTGTTCTT 47 ||||||||||||||||||||||||||||||||||| | || ||||||| Sbjct 47563 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGCCGCATTTGTTCTT 47612
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
47563
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
47765
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
26.05
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 72.0 bits (66.2), Expect = 6.82E-09 Identities = 36/36 (100%), Gaps = 0/36 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAG 36 |||||||||||||||||||||||||||||||||||| Sbjct 84151 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAG 84186
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
84151
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
84342
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
23.9
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 72.0 bits (66.2), Expect = 6.82E-09 Identities = 36/36 (100%), Gaps = 0/36 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAG 36 |||||||||||||||||||||||||||||||||||| Sbjct 111656 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAG 111691
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
111656
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
111854
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
24.06
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 70.0 bits (64.4), Expect = 2.38E-08 Identities = 101/141 (72%), Gaps = 3/141 (2%) Strand = Plus/Plus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAATATATTAAAT 96 |||||||||||||||||| ||||||||||||| | | | || || | | |||||||||| Sbjct 130748 AGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-ATATATTAAAC 130810 Query 97 GGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTA 160 ||||||||| || ||| || | |||||||| | || ||||| | | | |||| Sbjct 130811 TGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGTCTCGGTA 130874 Query 161 TTGCAGTACCTCC 173 ||||| ||| ||| Sbjct 130875 TTGCACTACATCC 130887
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
130713
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
130902
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
85.17
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 66.0 bits (60.8), Expect = 2.90E-07 Identities = 33/33 (100%), Gaps = 0/33 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTG 33 ||||||||||||||||||||||||||||||||| Sbjct 132222 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTG 132254
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
132222
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
132411
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
22.82
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 65.0 bits (59.9), Expect = 1.01E-06 Identities = 100/141 (71%), Gaps = 3/141 (2%) Strand = Plus/Plus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTT 102 || ||||||||||||||| ||||||||||||| | | | || || | | |||||||||| ||||| Sbjct 819 AGAATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTT 887 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTC 172 |||| || ||| || | |||||||| | || ||||| | | | ||||||||| ||| || Sbjct 888 TTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATC 957 Query 173 C 173 | Sbjct 958 C 958
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
786
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
973
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
81.88
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 65.0 bits (59.9), Expect = 1.01E-06 Identities = 34/35 (97%), Gaps = 0/35 (0%) Strand = Plus/Plus Query 24 AGATCAAGTGTAGTATCTGTTCTTATCAGTTTAAT 58 ||||||||||||||||||||||||||||| ||||| Sbjct 32843 AGATCAAGTGTAGTATCTGTTCTTATCAGCTTAAT 32877
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
32821
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
33005
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-2.29
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 65.0 bits (59.9), Expect = 1.01E-06 Identities = 100/141 (71%), Gaps = 3/141 (2%) Strand = Plus/Plus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAATATATTAAATGG 98 || ||||||||||||||| ||||||||||||| | | | || || | | |||||||||| | Sbjct 37266 AGAATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-ATATATTAAACTG 37330 Query 99 ATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGC 164 |||||||| || ||| || | |||||||| | || ||||| | | | |||||||| Sbjct 37331 ATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGC 37396 Query 165 AGTACCTCC 173 | ||| ||| Sbjct 37397 ACTACATCC 37405
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
37233
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
37420
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
81.88
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 64.0 bits (59.0), Expect = 1.01E-06 Identities = 32/32 (100%), Gaps = 0/32 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGT 32 |||||||||||||||||||||||||||||||| Sbjct 68904 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGT 68935
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
68904
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
69089
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
13.75
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 62.0 bits (57.2), Expect = 3.53E-06 Identities = 97/137 (71%), Gaps = 3/137 (2%) Strand = Plus/Plus Query 39 TCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTT 104 |||||||||||||| ||||||||||||| | | | || || | | |||||||||| ||||||| Sbjct 6731 TCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTTTT 6797 Query 105 GGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTC 172 || || ||| || | |||||||| | || ||||| | | | ||||||||| ||| || Sbjct 6798 GGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATC 6865 Query 173 C 173 | Sbjct 6866 C 6866
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
6695
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
6881
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
90.3
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 62.0 bits (57.2), Expect = 3.53E-06 Identities = 97/137 (71%), Gaps = 3/137 (2%) Strand = Plus/Plus Query 39 TCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTT 102 |||||||||||||| ||||||||||||| | | | || || | | |||||||||| ||||| Sbjct 23077 TCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTT 23141 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTA 168 |||| || ||| || | |||||||| | || ||||| | | | ||||||||| || Sbjct 23142 TTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTA 23207 Query 169 CCTCC 173 | ||| Sbjct 23208 CATCC 23212
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
23041
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
23227
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
90.3
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 62.0 bits (57.2), Expect = 3.53E-06 Identities = 97/137 (71%), Gaps = 3/137 (2%) Strand = Plus/Plus Query 39 TCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTT 102 |||||||||||||| ||||||||||||| | | | || || | | |||||||||| ||||| Sbjct 52705 TCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTT 52769 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTA 168 |||| || ||| || | |||||||| | || ||||| | | | ||||||||| || Sbjct 52770 TTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTA 52835 Query 169 CCTCC 173 | ||| Sbjct 52836 CATCC 52840
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
52664
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
52855
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
84.65
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 62.0 bits (57.2), Expect = 3.53E-06 Identities = 97/137 (71%), Gaps = 3/137 (2%) Strand = Plus/Plus Query 39 TCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAATATATTAAATGGAT 100 |||||||||||||| ||||||||||||| | | | || || | | |||||||||| ||| Sbjct 116703 TCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-ATATATTAAACTGAT 116765 Query 101 TTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGC 164 |||||| || ||| || | |||||||| | || ||||| | | | |||||||| Sbjct 116766 TTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGC 116829 Query 165 AGTACCTCC 173 | ||| ||| Sbjct 116830 ACTACATCC 116838
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
116666
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
116853
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
82.34
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 54.0 bits (50.0), Expect = 5.25E-04 Identities = 34/36 (94%), Gaps = 2/36 (6%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAG 36 |||||||||||||||||||||| ||||| ||||||| Sbjct 65599 ATCGCTTCTCGGCCTTTTGGCT-AGATC-AGTGTAG 65632
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
65599
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
65808
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
8.4
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 54.0 bits (50.0), Expect = 5.25E-04 Identities = 27/27 (100%), Gaps = 0/27 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGAT 27 ||||||||||||||||||||||||||| Sbjct 118170 ATCGCTTCTCGGCCTTTTGGCTAAGAT 118196
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
118170
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
118361
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
2.5700000000000003
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 52.0 bits (48.2), Expect = 1.83E-03 Identities = 26/26 (100%), Gaps = 0/26 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGA 26 |||||||||||||||||||||||||| Sbjct 24533 ATCGCTTCTCGGCCTTTTGGCTAAGA 24558
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
24533
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
24723
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-0.62
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 52.0 bits (48.2), Expect = 1.83E-03 Identities = 26/26 (100%), Gaps = 0/26 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGA 26 |||||||||||||||||||||||||| Sbjct 55618 ATCGCTTCTCGGCCTTTTGGCTAAGA 55643
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
55618
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
55806
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-1.83
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 52.0 bits (48.2), Expect = 1.83E-03 Identities = 26/26 (100%), Gaps = 0/26 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGA 26 |||||||||||||||||||||||||| Sbjct 76660 ATCGCTTCTCGGCCTTTTGGCTAAGA 76685
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
76660
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
76842
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
2.13
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 52.0 bits (48.2), Expect = 1.83E-03 Identities = 26/26 (100%), Gaps = 0/26 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGA 26 |||||||||||||||||||||||||| Sbjct 103669 ATCGCTTCTCGGCCTTTTGGCTAAGA 103694
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
103669
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
103859
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-0.62
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 51.0 bits (47.3), Expect = 6.39E-03 Identities = 27/28 (96%), Gaps = 0/28 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATC 28 |||||||||||||||||||||||| ||| Sbjct 8177 ATCGCTTCTCGGCCTTTTGGCTAATATC 8204
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
8177
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
8348
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-7.64
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163288.1

NW_021163288.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000278F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 45.0 bits (41.9), Expect = 2.72E-01 Identities = 24/25 (96%), Gaps = 0/25 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 |||||||||||||||||||||| || Sbjct 125273 ATCGCTTCTCGGCCTTTTGGCTCAG 125297
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
125273
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
125463
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-0.5
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163415.1

NW_021163415.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000405F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 138.0 bits (125.7), Expect = 8.31E-27 Identities = 135/175 (77%), Gaps = 3/175 (2%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 70691 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 70756 Query 67 CG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTT 130 | | | || || | | |||||||||| ||||||||| || ||| || | ||||| Sbjct 70757 TGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTT 70821 Query 131 GCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||| | || ||||| | | | ||||||||| ||| ||| Sbjct 70822 GCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATCC 70864
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
70691
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
70879
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
136.06
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163415.1

NW_021163415.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000405F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 138.0 bits (125.7), Expect = 8.31E-27 Identities = 135/175 (77%), Gaps = 3/175 (2%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 72187 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 72252 Query 67 CG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTT 130 | | | || || | | |||||||||| ||||||||| || ||| || | ||||| Sbjct 72253 TGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTT 72317 Query 131 GCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||| | || ||||| | | | ||||||||| ||| ||| Sbjct 72318 GCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATCC 72360
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
72187
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
72375
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
136.06
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163415.1

NW_021163415.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000405F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 138.0 bits (125.7), Expect = 8.31E-27 Identities = 135/175 (77%), Gaps = 3/175 (2%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 73685 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 73750 Query 67 CG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTT 130 | | | || || | | |||||||||| ||||||||| || ||| || | ||||| Sbjct 73751 TGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTT 73815 Query 131 GCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||| | || ||||| | | | ||||||||| ||| ||| Sbjct 73816 GCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATCC 73858
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
73685
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
73873
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
136.06
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163415.1

NW_021163415.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000405F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 138.0 bits (125.7), Expect = 8.31E-27 Identities = 135/175 (77%), Gaps = 3/175 (2%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 75184 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 75249 Query 67 CG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTT 130 | | | || || | | |||||||||| ||||||||| || ||| || | ||||| Sbjct 75250 TGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTT 75314 Query 131 GCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||| | || ||||| | | | ||||||||| ||| ||| Sbjct 75315 GCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATCC 75357
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
75184
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
75372
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
136.06
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163415.1

NW_021163415.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000405F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 138.0 bits (125.7), Expect = 8.31E-27 Identities = 135/175 (77%), Gaps = 3/175 (2%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 76682 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 76747 Query 67 CG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTT 130 | | | || || | | |||||||||| ||||||||| || ||| || | ||||| Sbjct 76748 TGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTT 76812 Query 131 GCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||| | || ||||| | | | ||||||||| ||| ||| Sbjct 76813 GCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATCC 76855
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
76682
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
76870
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
136.06
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163415.1

NW_021163415.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000405F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 106.0 bits (96.9), Expect = 4.03E-18 Identities = 119/159 (75%), Gaps = 3/159 (2%) Strand = Plus/Plus Query 17 TTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGA 80 |||||||||||||||||||||||||||||||||||| ||||||||||||| | | | || || | Sbjct 69209 TTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTA 69274 Query 81 GGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCAC 146 | |||||||||| ||||||||| || ||| || | |||||||| | || |||| Sbjct 69275 ACTC-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCAC 69339 Query 147 GCATCGACCTGGTATTGCAGTACCTCC 173 | | | | ||||||||| ||| ||| Sbjct 69340 GGGTTGTCTCGGTATTGCACTACATCC 69366
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
69195
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
69381
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
86.71
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163941.1

NW_021163941.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000931F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 138.0 bits (125.7), Expect = 8.31E-27 Identities = 135/175 (77%), Gaps = 3/175 (2%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | Sbjct 1761 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATG 1828 Query 69 -TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTC 134 | | || || | | |||||||||| ||||||||| || ||| || | |||||||| Sbjct 1829 TTAGGCAATGCCTAACTC-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTT 1895 Query 135 TGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 | || ||||| | | | ||||||||| ||| ||| Sbjct 1896 CGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATCC 1934
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
1761
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1949
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
136.06
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163941.1

NW_021163941.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000931F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 138.0 bits (125.7), Expect = 8.31E-27 Identities = 135/175 (77%), Gaps = 3/175 (2%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | Sbjct 3256 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATG 3323 Query 69 -TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTC 134 | | || || | | |||||||||| ||||||||| || ||| || | |||||||| Sbjct 3324 TTAGGCAATGCCTAACTC-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTT 3390 Query 135 TGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 | || ||||| | | | ||||||||| ||| ||| Sbjct 3391 CGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATCC 3429
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
3256
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
3444
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
136.06
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163941.1

NW_021163941.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000931F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 138.0 bits (125.7), Expect = 8.31E-27 Identities = 135/175 (77%), Gaps = 3/175 (2%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | Sbjct 6252 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATG 6319 Query 69 -TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTC 134 | | || || | | |||||||||| ||||||||| || ||| || | |||||||| Sbjct 6320 TTAGGCAATGCCTAACTC-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTT 6386 Query 135 TGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 | || ||||| | | | ||||||||| ||| ||| Sbjct 6387 CGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATCC 6425
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
6252
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
6440
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
136.06
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163941.1

NW_021163941.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000931F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 138.0 bits (125.7), Expect = 8.31E-27 Identities = 135/175 (77%), Gaps = 3/175 (2%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | Sbjct 7750 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATG 7817 Query 69 -TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTC 134 | | || || | | |||||||||| ||||||||| || ||| || | |||||||| Sbjct 7818 TTAGGCAATGCCTAACTC-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTT 7884 Query 135 TGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 | || ||||| | | | ||||||||| ||| ||| Sbjct 7885 CGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATCC 7923
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
7750
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
7938
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
136.06
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163941.1

NW_021163941.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000931F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 138.0 bits (125.7), Expect = 8.31E-27 Identities = 135/175 (77%), Gaps = 3/175 (2%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 11057 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 11122 Query 67 CG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTT 130 | | | || || | | |||||||||| ||||||||| || ||| || | ||||| Sbjct 11123 TGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTT 11187 Query 131 GCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||| | || ||||| | | | ||||||||| ||| ||| Sbjct 11188 GCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATCC 11230
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
11057
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
11245
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
136.06
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163941.1

NW_021163941.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000931F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 138.0 bits (125.7), Expect = 8.31E-27 Identities = 135/175 (77%), Gaps = 3/175 (2%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 14043 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 14108 Query 67 CG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTT 130 | | | || || | | |||||||||| ||||||||| || ||| || | ||||| Sbjct 14109 TGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTT 14173 Query 131 GCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||| | || ||||| | | | ||||||||| ||| ||| Sbjct 14174 GCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATCC 14216
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
14043
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
14231
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
136.06
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163941.1

NW_021163941.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000931F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 138.0 bits (125.7), Expect = 8.31E-27 Identities = 135/175 (77%), Gaps = 3/175 (2%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 15541 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 15606 Query 67 CG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTT 130 | | | || || | | |||||||||| ||||||||| || ||| || | ||||| Sbjct 15607 TGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTT 15671 Query 131 GCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||| | || ||||| | | | ||||||||| ||| ||| Sbjct 15672 GCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATCC 15714
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
15541
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
15729
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
136.06
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163941.1

NW_021163941.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000931F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 138.0 bits (125.7), Expect = 8.31E-27 Identities = 135/175 (77%), Gaps = 3/175 (2%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 17039 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATA 17104 Query 67 CG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTT 130 | | | || || | | |||||||||| ||||||||| || ||| || | ||||| Sbjct 17105 TGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTT 17169 Query 131 GCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||| | || ||||| | | | ||||||||| ||| ||| Sbjct 17170 GCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATCC 17212
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
17039
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
17227
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
136.06
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163941.1

NW_021163941.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000931F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 129.0 bits (117.6), Expect = 4.30E-24 Identities = 93/108 (86%), Gaps = 3/108 (3%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | Sbjct 4753 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATG 4820 Query 69 -TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTTGG 106 | | || || | | |||||||||| ||||||||| Sbjct 4821 TTAGGCAATGCCTAACTC-ATATATTAAACTGATTTTTGG 4859
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
4753
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
4942
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
116.49
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163941.1

NW_021163941.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000931F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 102.0 bits (93.3), Expect = 4.91E-17 Identities = 131/175 (75%), Gaps = 7/175 (4%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 ||||||||||| |||||||||||||||||||| ||| ||||||||||||||| ||||| ||||||| Sbjct 12551 ATCGCTTCTCG-CCTTTTGGCTAAGATCAAGT-TAG-ATCTGTTCTTATCAGCTTAAT-TCTGATA 12612 Query 67 CG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTT 130 | | | || || | | |||||||||| ||||||||| || ||| || | ||||| Sbjct 12613 TGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTT 12677 Query 131 GCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||| | || ||||| | | | ||||||||| ||| ||| Sbjct 12678 GCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATCC 12720
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
12551
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
12735
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
102.81
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163941.1

NW_021163941.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000931F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 92.0 bits (84.2), Expect = 2.54E-14 Identities = 112/152 (74%), Gaps = 3/152 (2%) Strand = Plus/Plus Query 24 AGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAATAT 89 ||||||||||||||||||||||||||||| ||||||||||||| | | | || || | | |||| Sbjct 9583 AGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-ATAT 9649 Query 90 ATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTG 157 |||||| ||||||||| || ||| || | |||||||| | || ||||| | | | | Sbjct 9650 ATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGTCTCG 9717 Query 158 GTATTGCAGTACCTCC 173 |||||||| ||| ||| Sbjct 9718 GTATTGCACTACATCC 9733
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
9560
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
9748
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
88.01
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163941.1

NW_021163941.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000931F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 74.0 bits (68.0), Expect = 1.96E-09 Identities = 37/37 (100%), Gaps = 0/37 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGT 37 ||||||||||||||||||||||||||||||||||||| Sbjct 9242 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGT 9278
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
9242
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
9424
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
29.3
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163941.1

NW_021163941.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000931F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 54.0 bits (50.0), Expect = 5.25E-04 Identities = 96/137 (70%), Gaps = 5/137 (4%) Strand = Plus/Plus Query 39 TCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTTGG 106 |||||||||||||| ||||||||||||| | | | || || | || ||| ||||| ||||||||| Sbjct 306 TCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTA--ACTCTAT-TTAAACTGATTTTTGG 372 Query 107 AGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 || ||| || | |||||||| | || ||||| | | | ||||||||| ||| ||| Sbjct 373 CCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATCC 439
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
270
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
454
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
84.27
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163982.1

NW_021163982.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000972F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 138.0 bits (125.7), Expect = 8.31E-27 Identities = 135/175 (77%), Gaps = 3/175 (2%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | Sbjct 1767 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATG 1834 Query 69 -TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTC 134 | | || || | | |||||||||| ||||||||| || ||| || | |||||||| Sbjct 1835 TTAGGCAATGCCTAACTC-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTT 1901 Query 135 TGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 | || ||||| | | | ||||||||| ||| ||| Sbjct 1902 CGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATCC 1940
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
1767
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1955
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
136.06
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163982.1

NW_021163982.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000972F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 138.0 bits (125.7), Expect = 8.31E-27 Identities = 135/175 (77%), Gaps = 3/175 (2%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | Sbjct 6654 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATG 6721 Query 69 -TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTC 134 | | || || | | |||||||||| ||||||||| || ||| || | |||||||| Sbjct 6722 TTAGGCAATGCCTAACTC-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTT 6788 Query 135 TGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 | || ||||| | | | ||||||||| ||| ||| Sbjct 6789 CGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATCC 6827
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
6654
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
6842
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
136.06
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163982.1

NW_021163982.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000972F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 138.0 bits (125.7), Expect = 8.31E-27 Identities = 135/175 (77%), Gaps = 3/175 (2%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | Sbjct 8151 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATG 8218 Query 69 -TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTC 134 | | || || | | |||||||||| ||||||||| || ||| || | |||||||| Sbjct 8219 TTAGGCAATGCCTAACTC-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTT 8285 Query 135 TGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 | || ||||| | | | ||||||||| ||| ||| Sbjct 8286 CGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATCC 8324
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
8151
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
8339
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
136.06
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163982.1

NW_021163982.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000972F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 138.0 bits (125.7), Expect = 8.31E-27 Identities = 135/175 (77%), Gaps = 3/175 (2%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | Sbjct 9648 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATG 9715 Query 69 -TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTC 134 | | || || | | |||||||||| ||||||||| || ||| || | |||||||| Sbjct 9716 TTAGGCAATGCCTAACTC-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTT 9782 Query 135 TGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 | || ||||| | | | ||||||||| ||| ||| Sbjct 9783 CGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATCC 9821
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
9648
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
9836
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
136.06
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163982.1

NW_021163982.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000972F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 111.0 bits (101.4), Expect = 3.31E-19 Identities = 57/58 (98%), Gaps = 0/58 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAAT 58 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct 11146 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAAT 11203
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
11146
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
11331
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
40.82
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163982.1

NW_021163982.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000972F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 87.0 bits (79.7), Expect = 1.08E-12 Identities = 113/154 (73%), Gaps = 4/154 (3%) Strand = Plus/Plus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAAT 87 |||||||||||||||||||||||||| |||| ||||||||||||| | | | || || | | || Sbjct 5177 TAAGATCAAGTGTAGTATCTGTTCTT-TCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-AT 5242 Query 88 ATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACC 155 |||||||| ||||||||| || ||| || | |||||||| | || ||||| | | | Sbjct 5243 ATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGTCT 5310 Query 156 TGGTATTGCAGTACCTCC 173 ||||||||| ||| ||| Sbjct 5311 CGGTATTGCACTACATCC 5328
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
5156
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
5343
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
71.55
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163982.1

NW_021163982.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000972F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 72.0 bits (66.2), Expect = 6.82E-09 Identities = 36/36 (100%), Gaps = 0/36 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAG 36 |||||||||||||||||||||||||||||||||||| Sbjct 3265 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAG 3300
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
3265
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
3438
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
25.21
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163982.1

NW_021163982.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000972F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 62.0 bits (57.2), Expect = 3.53E-06 Identities = 97/137 (71%), Gaps = 3/137 (2%) Strand = Plus/Plus Query 39 TCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTTTTGG 106 |||||||||||||| ||||||||||||| | | | || || | | |||||||||| ||||||||| Sbjct 307 TCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTTTTGG 375 Query 107 AGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 || ||| || | |||||||| | || ||||| | | | ||||||||| ||| ||| Sbjct 376 CCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTACATCC 442
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
271
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
457
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
90.3
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_001833172.1

NW_001833172.1 Nematostella vectensis NEMVEscaffold_1318 genomic scaffold, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 130.0 bits (118.5), Expect = 1.23E-24 Identities = 123/159 (77%), Gaps = 2/159 (1%) Strand = Plus/Plus Query 17 TTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAG 81 |||||||||||||||||||||||||||||||||||| ||||||||||||||| | ||| | | Sbjct 34288 TTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATACGCTGCTCATTGAGTA 34353 Query 82 GACAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAAT-AGGAGCTTGCTCTGTCCACTCCAC 146 | |||||||||| |||||||||| || |||||| || ||||||| |||| |||| Sbjct 34354 GCTCATATATTAAACTGATTTTTGGAAACTGGCTGTGGAATAAGCGGCTTGCTGCGTCCCAGCCAC 34419 Query 147 GCATCGACCTGGTATTGCAGTACCTCC 173 | | | | ||||||||| ||||||| Sbjct 34420 GGGTTGTCTCGGTATTGCACTACCTCC 34446
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
34272
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
34461
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
80.85
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Ambiguous base detected in uid:285|NW_001833172.1fw, violating base NNNNNNNNNNNNNNNN, pos 0

Hit: NW_004172188.1

NW_004172188.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_34013, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 125.0 bits (114.0), Expect = 5.24E-23 Identities = 91/108 (84%), Gaps = 4/108 (4%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || Sbjct 50232 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTA 50167 Query 67 CGTC--CTCTATCCGAGGACAATATATTAAATGGATTTTTGG 106 || | | | ||| || ||||||||| ||||||||| Sbjct 50166 CGCCGGCACAGTCC--GGCTCATATATTAATCTGATTTTTGG 50127
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
50045
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
50233
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
109.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004172188.1

NW_004172188.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_34013, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 125.0 bits (114.0), Expect = 5.24E-23 Identities = 91/108 (84%), Gaps = 4/108 (4%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || Sbjct 50599 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTA 50534 Query 67 CGTC--CTCTATCCGAGGACAATATATTAAATGGATTTTTGG 106 || | | | ||| || ||||||||| ||||||||| Sbjct 50533 CGCCGGCACAGTCC--GGCTCATATATTAATCTGATTTTTGG 50494
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
50412
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
50600
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
109.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004176286.1

NW_004176286.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_29907, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 125.0 bits (114.0), Expect = 5.24E-23 Identities = 91/108 (84%), Gaps = 4/108 (4%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct 9098 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTACG 9031 Query 69 TC--CTCTATCCGAGGACAATATATTAAATGGATTTTTGG 106 | | | ||| || ||||||||| ||||||||| Sbjct 9030 CCGGCACAGTCC--GGCTCATATATTAATCTGATTTTTGG 8993
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
8911
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
9099
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
109.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004177926.1

NW_004177926.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_28263, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 125.0 bits (114.0), Expect = 5.24E-23 Identities = 91/108 (84%), Gaps = 4/108 (4%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct 6004 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTACG 5937 Query 69 TC--CTCTATCCGAGGACAATATATTAAATGGATTTTTGG 106 | | | ||| || ||||||||| ||||||||| Sbjct 5936 CCGGCACAGTCC--GGCTCATATATTAATCTGATTTTTGG 5899
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
5817
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
6005
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
66.01
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Ambiguous base detected in uid:289|NW_004177926.1rc, violating base NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN, pos 142

Hit: NW_004177926.1

NW_004177926.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_28263, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 125.0 bits (114.0), Expect = 5.24E-23 Identities = 91/108 (84%), Gaps = 4/108 (4%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || Sbjct 12110 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTA 12045 Query 67 CGTC--CTCTATCCGAGGACAATATATTAAATGGATTTTTGG 106 || | | | ||| || ||||||||| ||||||||| Sbjct 12044 CGCCGGCACAGTCC--GGCTCATATATTAATCTGATTTTTGG 12005
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
11923
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
12111
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
109.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004177926.1

NW_004177926.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_28263, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 125.0 bits (114.0), Expect = 5.24E-23 Identities = 91/108 (84%), Gaps = 4/108 (4%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || Sbjct 12477 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTA 12412 Query 67 CGTC--CTCTATCCGAGGACAATATATTAAATGGATTTTTGG 106 || | | | ||| || ||||||||| ||||||||| Sbjct 12411 CGCCGGCACAGTCC--GGCTCATATATTAATCTGATTTTTGG 12372
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
12290
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
12478
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
109.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004177926.1

NW_004177926.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_28263, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 88.0 bits (80.6), Expect = 3.10E-13 Identities = 47/49 (96%), Gaps = 0/49 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 ||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 1943 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 1895
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
1756
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1938
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
31.85
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004177926.1

NW_004177926.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_28263, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 88.0 bits (80.6), Expect = 3.10E-13 Identities = 47/49 (96%), Gaps = 0/49 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 ||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 11743 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 11695
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
11556
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
11749
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
27.23
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004177926.1

NW_004177926.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_28263, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 84.0 bits (77.0), Expect = 3.77E-12 Identities = 45/47 (96%), Gaps = 0/47 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTT 47 ||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 1120 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTT 1074
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
933
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1117
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
27.57
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004177926.1

NW_004177926.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_28263, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 84.0 bits (77.0), Expect = 3.77E-12 Identities = 45/47 (96%), Gaps = 0/47 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTT 47 ||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 15062 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTT 15016
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
14875
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
15056
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
26.34
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004177926.1

NW_004177926.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_28263, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 82.0 bits (75.2), Expect = 1.32E-11 Identities = 44/46 (96%), Gaps = 0/46 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCT 46 ||||||||||||||| ||||||||||||||||||||||||||||| Sbjct 1181 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCT 1136
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
994
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1182
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
28.87
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004177926.1

NW_004177926.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_28263, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 67.0 bits (61.7), Expect = 2.90E-07 Identities = 59/74 (80%), Gaps = 4/74 (5%) Strand = Plus/Minus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGGAT 100 ||||||||||||||||||||||||||||| |||| | | | ||| || ||||||||| ||| Sbjct 1514 AGTATCTGTTCTTATCAGTTTAATATCTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCTGAT 1449 Query 101 TTTTGG 106 |||||| Sbjct 1448 TTTTGG 1443
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
1361
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1549
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
57.25
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004177926.1

NW_004177926.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_28263, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 67.0 bits (61.7), Expect = 2.90E-07 Identities = 59/74 (80%), Gaps = 4/74 (5%) Strand = Plus/Minus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGGAT 100 ||||||||||||||||||||||||||||| |||| | | | ||| || ||||||||| ||| Sbjct 6337 AGTATCTGTTCTTATCAGTTTAATATCTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCTGAT 6272 Query 101 TTTTGG 106 |||||| Sbjct 6271 TTTTGG 6266
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
6184
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
6372
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
54.14
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004177926.1

NW_004177926.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_28263, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 67.0 bits (61.7), Expect = 2.90E-07 Identities = 59/74 (80%), Gaps = 4/74 (5%) Strand = Plus/Minus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGG 98 ||||||||||||||||||||||||||||| |||| | | | ||| || ||||||||| | Sbjct 15395 AGTATCTGTTCTTATCAGTTTAATATCTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCTG 15332 Query 99 ATTTTTGG 106 |||||||| Sbjct 15331 ATTTTTGG 15324
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
15242
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
15430
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
59.79
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004177926.1

NW_004177926.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_28263, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 42.0 bits (39.2), Expect = 9.49E-01 Identities = 24/26 (92%), Gaps = 0/26 (0%) Strand = Plus/Minus Query 21 CTAAGATCAAGTGTAGTATCTGTTCT 46 |||||||||||||||||||| |||| Sbjct 1137 CTAAGATCAAGTGTAGTATCGCTTCT 1112
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
971
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1173
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-14.32
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004178899.1

NW_004178899.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_27290, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 125.0 bits (114.0), Expect = 5.24E-23 Identities = 91/108 (84%), Gaps = 4/108 (4%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct 3652 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTACG 3585 Query 69 TC--CTCTATCCGAGGACAATATATTAAATGGATTTTTGG 106 | | | ||| || ||||||||| ||||||||| Sbjct 3584 CCGGCACAGTCC--GGCTCATATATTAATCTGATTTTTGG 3547
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
3465
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
3653
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
109.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004178899.1

NW_004178899.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_27290, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 88.0 bits (80.6), Expect = 3.10E-13 Identities = 47/49 (96%), Gaps = 0/49 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 ||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 7120 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 7072
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
6933
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
7114
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
29.89
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004178899.1

NW_004178899.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_27290, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 84.0 bits (77.0), Expect = 3.77E-12 Identities = 45/47 (96%), Gaps = 0/47 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTT 47 ||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 6356 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTT 6310
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
6169
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
6355
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
26.9
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004178899.1

NW_004178899.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_27290, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 84.0 bits (77.0), Expect = 3.77E-12 Identities = 45/47 (96%), Gaps = 0/47 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTT 47 ||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 11305 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTT 11259
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
11118
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
11301
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
27.23
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004178899.1

NW_004178899.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_27290, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 73.0 bits (67.1), Expect = 6.82E-09 Identities = 62/77 (81%), Gaps = 4/77 (5%) Strand = Plus/Minus Query 32 TGTAGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATG 97 |||||||||||||||||||||||||||||||| |||| | | | ||| || ||||||||| Sbjct 3988 TGTAGTATCTGTTCTTATCAGTTTAATATCTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCT 3923 Query 98 GATTTTTGG 106 ||||||||| Sbjct 3922 GATTTTTGG 3914
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
3832
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
4020
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
56.12
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Ambiguous base detected in uid:305|NW_004178899.1rc, violating base NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN, pos 0

Hit: NW_004178899.1

NW_004178899.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_27290, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 67.0 bits (61.7), Expect = 2.90E-07 Identities = 59/74 (80%), Gaps = 4/74 (5%) Strand = Plus/Minus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGGAT 100 ||||||||||||||||||||||||||||| |||| | | | ||| || ||||||||| ||| Sbjct 6689 AGTATCTGTTCTTATCAGTTTAATATCTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCTGAT 6624 Query 101 TTTTGG 106 |||||| Sbjct 6623 TTTTGG 6618
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
6535
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
6724
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
55.95
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004178899.1

NW_004178899.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_27290, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 67.0 bits (61.7), Expect = 2.90E-07 Identities = 59/74 (80%), Gaps = 4/74 (5%) Strand = Plus/Minus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGGAT 100 ||||||||||||||||||||||||||||| |||| | | | ||| || ||||||||| ||| Sbjct 7453 AGTATCTGTTCTTATCAGTTTAATATCTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCTGAT 7388 Query 101 TTTTGG 106 |||||| Sbjct 7387 TTTTGG 7382
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
7300
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
7488
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
57.5
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004178899.1

NW_004178899.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_27290, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 67.0 bits (61.7), Expect = 2.90E-07 Identities = 59/74 (80%), Gaps = 4/74 (5%) Strand = Plus/Minus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGG 98 ||||||||||||||||||||||||||||| |||| | | | ||| || ||||||||| | Sbjct 11638 AGTATCTGTTCTTATCAGTTTAATATCTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCTG 11575 Query 99 ATTTTTGG 106 |||||||| Sbjct 11574 ATTTTTGG 11567
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
11485
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
11673
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
56.04
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004178899.1

NW_004178899.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_27290, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 47.0 bits (43.7), Expect = 7.79E-02 Identities = 28/31 (90%), Gaps = 0/31 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAG 31 || |||||||||||| |||||||||||||| Sbjct 3285 ATTGCTTCTCGGCCTAATGGCTAAGATCAAG 3255
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
3098
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
3293
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
7.38
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004179462.1

NW_004179462.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_26726, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 125.0 bits (114.0), Expect = 5.24E-23 Identities = 91/108 (84%), Gaps = 4/108 (4%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct 1115 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTACG 1048 Query 69 TC--CTCTATCCGAGGACAATATATTAAATGGATTTTTGG 106 | | | ||| || ||||||||| ||||||||| Sbjct 1047 CCGGCACAGTCC--GGCTCATATATTAATCTGATTTTTGG 1010
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
928
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1116
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
109.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004179462.1

NW_004179462.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_26726, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 125.0 bits (114.0), Expect = 5.24E-23 Identities = 91/108 (84%), Gaps = 4/108 (4%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || Sbjct 10611 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTA 10546 Query 67 CGTC--CTCTATCCGAGGACAATATATTAAATGGATTTTTGG 106 || | | | ||| || ||||||||| ||||||||| Sbjct 10545 CGCCGGCACAGTCC--GGCTCATATATTAATCTGATTTTTGG 10506
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
10424
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
10612
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
109.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004179462.1

NW_004179462.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_26726, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 88.0 bits (80.6), Expect = 3.10E-13 Identities = 47/49 (96%), Gaps = 0/49 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 ||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 1867 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 1819
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
1680
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1862
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
31.85
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004179462.1

NW_004179462.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_26726, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 84.0 bits (77.0), Expect = 3.77E-12 Identities = 45/47 (96%), Gaps = 0/47 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTT 47 ||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 748 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTT 702
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
561
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
753
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
28.03
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004179462.1

NW_004179462.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_26726, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 84.0 bits (77.0), Expect = 3.77E-12 Identities = 45/47 (96%), Gaps = 0/47 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTT 47 ||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 10244 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTT 10198
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
10057
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
10241
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
27.53
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004179462.1

NW_004179462.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_26726, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 67.0 bits (61.7), Expect = 2.90E-07 Identities = 59/74 (80%), Gaps = 4/74 (5%) Strand = Plus/Minus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGGAT 100 ||||||||||||||||||||||||||||| |||| | | | ||| || ||||||||| ||| Sbjct 1448 AGTATCTGTTCTTATCAGTTTAATATCTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCTGAT 1383 Query 101 TTTTGG 106 |||||| Sbjct 1382 TTTTGG 1377
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
1294
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1483
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
56.07
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004180097.1

NW_004180097.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_26086, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 125.0 bits (114.0), Expect = 5.24E-23 Identities = 91/108 (84%), Gaps = 4/108 (4%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACGTC 70 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| | Sbjct 154 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTACGCC 223 Query 71 --CTCTATCCGAGGACAATATATTAAATGGATTTTTGG 106 | | ||| || ||||||||| ||||||||| Sbjct 224 GGCACAGTCC--GGCTCATATATTAATCTGATTTTTGG 259
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
154
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
342
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
109.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004180097.1

NW_004180097.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_26086, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 120.0 bits (109.5), Expect = 6.39E-22 Identities = 90/108 (83%), Gaps = 4/108 (4%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 ||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| || |||| Sbjct 8641 ATCGCTTTTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATTTGGTACG 8708 Query 69 TC--CTCTATCCGAGGACAATATATTAAATGGATTTTTGG 106 | | | ||| || ||||||||| | ||||||||| Sbjct 8709 CCGGCCCAGTCC--GGCTCATATATTAATTTGATTTTTGG 8746
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
8641
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
8829
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
104.92
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004180097.1

NW_004180097.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_26086, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 92.0 bits (84.2), Expect = 2.54E-14 Identities = 49/51 (96%), Gaps = 0/51 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCA 51 ||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct 521 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCA 571
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
521
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
721
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
26.98
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004180097.1

NW_004180097.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_26086, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 74.0 bits (68.0), Expect = 1.96E-09 Identities = 43/47 (91%), Gaps = 0/47 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTT 47 ||||||| ||||||| |||||||||||||| ||||||||||||||| Sbjct 9008 ATCGCTTTTCGGCCTAATGGCTAAGATCAAGGGTAGTATCTGTTCTT 9054
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
9008
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
9197
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
19.11
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004180097.1

NW_004180097.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_26086, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 67.0 bits (61.7), Expect = 2.90E-07 Identities = 59/74 (80%), Gaps = 4/74 (5%) Strand = Plus/Plus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGGAT 100 ||||||||||||||||||||||||||||| |||| | | | ||| || ||||||||| ||| Sbjct 8308 AGTATCTGTTCTTATCAGTTTAATATCTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCTGAT 8373 Query 101 TTTTGG 106 |||||| Sbjct 8374 TTTTGG 8379
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
8273
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
8462
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
55.86
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004182753.1

NW_004182753.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_23412, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 125.0 bits (114.0), Expect = 5.24E-23 Identities = 91/108 (84%), Gaps = 4/108 (4%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct 4137 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTACG 4070 Query 69 TC--CTCTATCCGAGGACAATATATTAAATGGATTTTTGG 106 | | | ||| || ||||||||| ||||||||| Sbjct 4069 CCGGCACAGTCC--GGCTCATATATTAATCTGATTTTTGG 4032
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
3950
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
4138
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
109.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004182753.1

NW_004182753.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_23412, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 101.0 bits (92.4), Expect = 1.71E-16 Identities = 76/91 (84%), Gaps = 4/91 (4%) Strand = Plus/Minus Query 18 TGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGA 83 |||||||||||||||||||||||||||||||||||||||||||||| |||| | | | ||| || Sbjct 4474 TGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTACGCCGGCACAGTCC--GGC 4409 Query 84 CAATATATTAAATGGATTTTTGG 106 ||||||||| ||||||||| Sbjct 4408 TCATATATTAATCTGATTTTTGG 4386
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
4274
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
4440
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
36.4
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

NW_004182753.1: Sequence cannot be extended sufficiently. Missing nt downstream in the genome.
NW_004182753.1: Sequence cannot be extended sufficiently by unalined portion of query. THIS IS PROBABLY FRAGMENT! Trimmed downstream.

Hit: NW_004182753.1

NW_004182753.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_23412, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 94.0 bits (86.0), Expect = 7.29E-15 Identities = 50/52 (96%), Gaps = 0/52 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAG 52 ||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct 867 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAG 816
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
680
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
862
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
31.53
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004182753.1

NW_004182753.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_23412, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 88.0 bits (80.6), Expect = 3.10E-13 Identities = 47/49 (96%), Gaps = 0/49 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 ||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 774 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 726
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
587
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
769
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
31.81
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004182753.1

NW_004182753.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_23412, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 84.0 bits (77.0), Expect = 3.77E-12 Identities = 45/47 (96%), Gaps = 0/47 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTT 47 ||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 3770 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTT 3724
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
3583
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
3781
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
23.57
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004182753.1

NW_004182753.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_23412, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 67.0 bits (61.7), Expect = 2.90E-07 Identities = 59/74 (80%), Gaps = 4/74 (5%) Strand = Plus/Minus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGGATTT 102 ||||||||||||||||||||||||||||| |||| | | | ||| || ||||||||| ||||| Sbjct 342 AGTATCTGTTCTTATCAGTTTAATATCTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCTGATTT 275 Query 103 TTGG 106 |||| Sbjct 274 TTGG 271
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
189
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
377
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
55.45
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004182753.1

NW_004182753.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_23412, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 67.0 bits (61.7), Expect = 2.90E-07 Identities = 59/74 (80%), Gaps = 4/74 (5%) Strand = Plus/Minus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGGAT 100 ||||||||||||||||||||||||||||| |||| | | | ||| || ||||||||| ||| Sbjct 1200 AGTATCTGTTCTTATCAGTTTAATATCTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCTGAT 1135 Query 101 TTTTGG 106 |||||| Sbjct 1134 TTTTGG 1129
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
1047
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1235
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
55.95
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183207.1

NW_004183207.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22954, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 125.0 bits (114.0), Expect = 5.24E-23 Identities = 91/108 (84%), Gaps = 4/108 (4%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACGTC 70 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| | Sbjct 331 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTACGCC 400 Query 71 --CTCTATCCGAGGACAATATATTAAATGGATTTTTGG 106 | | ||| || ||||||||| ||||||||| Sbjct 401 GGCACAGTCC--GGCTCATATATTAATCTGATTTTTGG 436
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
331
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
519
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
109.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183207.1

NW_004183207.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22954, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 125.0 bits (114.0), Expect = 5.24E-23 Identities = 91/108 (84%), Gaps = 4/108 (4%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct 2259 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTACG 2326 Query 69 TC--CTCTATCCGAGGACAATATATTAAATGGATTTTTGG 106 | | | ||| || ||||||||| ||||||||| Sbjct 2327 CCGGCACAGTCC--GGCTCATATATTAATCTGATTTTTGG 2364
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
2259
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
2447
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
109.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183207.1

NW_004183207.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22954, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 88.0 bits (80.6), Expect = 3.10E-13 Identities = 47/49 (96%), Gaps = 0/49 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 ||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 698 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 746
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
698
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
880
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
31.76
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183207.1

NW_004183207.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22954, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 88.0 bits (80.6), Expect = 3.10E-13 Identities = 47/49 (96%), Gaps = 0/49 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 ||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 1459 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 1507
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
1459
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1641
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
31.68
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183207.1

NW_004183207.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22954, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 88.0 bits (80.6), Expect = 3.10E-13 Identities = 47/49 (96%), Gaps = 0/49 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 ||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 2626 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 2674
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
2626
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
2808
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
31.28
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183207.1

NW_004183207.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22954, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 88.0 bits (80.6), Expect = 3.10E-13 Identities = 47/49 (96%), Gaps = 0/49 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 ||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 3380 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 3428
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
3380
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
3561
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
31.64
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183207.1

NW_004183207.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22954, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 67.0 bits (61.7), Expect = 2.90E-07 Identities = 59/74 (80%), Gaps = 4/74 (5%) Strand = Plus/Plus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGGAT 100 ||||||||||||||||||||||||||||| |||| | | | ||| || ||||||||| ||| Sbjct 1126 AGTATCTGTTCTTATCAGTTTAATATCTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCTGAT 1191 Query 101 TTTTGG 106 |||||| Sbjct 1192 TTTTGG 1197
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
1092
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1280
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
55.29
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183207.1

NW_004183207.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22954, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 67.0 bits (61.7), Expect = 2.90E-07 Identities = 59/74 (80%), Gaps = 4/74 (5%) Strand = Plus/Plus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGGAT 100 ||||||||||||||||||||||||||||| |||| | | | ||| || ||||||||| ||| Sbjct 3047 AGTATCTGTTCTTATCAGTTTAATATCTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCTGAT 3112 Query 101 TTTTGG 106 |||||| Sbjct 3113 TTTTGG 3118
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
3013
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
3201
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
55.86
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183207.1

NW_004183207.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22954, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 61.0 bits (56.3), Expect = 1.23E-05 Identities = 56/71 (79%), Gaps = 4/71 (6%) Strand = Plus/Plus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGGATTTTTG 105 |||||||||||||||||||||||||| |||| | | | ||| || ||||||||| |||||||| Sbjct 1 ATCTGTTCTTATCAGTTTAATATCTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCTGATTTTTG 68 Query 106 G 106 | Sbjct 69 G 69
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
1
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
152
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
57.16
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

NW_004183207.1: Sequence cannot be extended sufficiently. Missing -66 nt upstream in the genome.
NW_004183207.1: Sequence cannot be extended sufficiently by unaligned portion of query. THIS IS PROBABLY FRAGMENT! Trimmed upstream.

Hit: NW_004183220.1

NW_004183220.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22941, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 125.0 bits (114.0), Expect = 5.24E-23 Identities = 91/108 (84%), Gaps = 4/108 (4%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct 2762 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTACG 2829 Query 69 TC--CTCTATCCGAGGACAATATATTAAATGGATTTTTGG 106 | | | ||| || ||||||||| ||||||||| Sbjct 2830 CCGGCACAGTCC--GGCTCATATATTAATCTGATTTTTGG 2867
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
2762
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
2950
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
109.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183220.1

NW_004183220.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22941, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 84.0 bits (77.0), Expect = 3.77E-12 Identities = 45/47 (96%), Gaps = 0/47 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTT 47 ||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 3129 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTT 3175
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
3129
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
3314
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
26.55
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183387.1

NW_004183387.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22773, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 125.0 bits (114.0), Expect = 5.24E-23 Identities = 91/108 (84%), Gaps = 4/108 (4%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct 3045 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTACG 3112 Query 69 TC--CTCTATCCGAGGACAATATATTAAATGGATTTTTGG 106 | | | ||| || ||||||||| ||||||||| Sbjct 3113 CCGGCACAGTCC--GGCTCATATATTAATCTGATTTTTGG 3150
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
3045
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
3233
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
109.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183387.1

NW_004183387.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22773, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 46.0 bits (42.8), Expect = 7.79E-02 Identities = 26/28 (93%), Gaps = 0/28 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATC 28 ||||||||||||||| ||||||||||| Sbjct 3412 ATCGCTTCTCGGCCTAATGGCTAAGATC 3439
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
3412
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
3590
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
4.85
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183505.1

NW_004183505.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22652, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 125.0 bits (114.0), Expect = 5.24E-23 Identities = 91/108 (84%), Gaps = 4/108 (4%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACGTC 70 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| | Sbjct 287 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTACGCC 218 Query 71 --CTCTATCCGAGGACAATATATTAAATGGATTTTTGG 106 | | ||| || ||||||||| ||||||||| Sbjct 217 GGCACAGTCC--GGCTCATATATTAATCTGATTTTTGG 182
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
100
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
288
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
109.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183505.1

NW_004183505.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22652, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 125.0 bits (114.0), Expect = 5.24E-23 Identities = 91/108 (84%), Gaps = 4/108 (4%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACGTC 70 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| | Sbjct 654 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTACGCC 585 Query 71 --CTCTATCCGAGGACAATATATTAAATGGATTTTTGG 106 | | ||| || ||||||||| ||||||||| Sbjct 584 GGCACAGTCC--GGCTCATATATTAATCTGATTTTTGG 549
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
467
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
655
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
109.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183505.1

NW_004183505.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22652, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 125.0 bits (114.0), Expect = 5.24E-23 Identities = 91/108 (84%), Gaps = 4/108 (4%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct 1021 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTACG 954 Query 69 TC--CTCTATCCGAGGACAATATATTAAATGGATTTTTGG 106 | | | ||| || ||||||||| ||||||||| Sbjct 953 CCGGCACAGTCC--GGCTCATATATTAATCTGATTTTTGG 916
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
834
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1022
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
109.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183505.1

NW_004183505.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22652, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 125.0 bits (114.0), Expect = 5.24E-23 Identities = 91/108 (84%), Gaps = 4/108 (4%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct 3264 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTACG 3197 Query 69 TC--CTCTATCCGAGGACAATATATTAAATGGATTTTTGG 106 | | | ||| || ||||||||| ||||||||| Sbjct 3196 CCGGCACAGTCC--GGCTCATATATTAATCTGATTTTTGG 3159
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
3077
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
3265
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
109.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183505.1

NW_004183505.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22652, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 125.0 bits (114.0), Expect = 5.24E-23 Identities = 91/108 (84%), Gaps = 4/108 (4%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct 3631 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTACG 3564 Query 69 TC--CTCTATCCGAGGACAATATATTAAATGGATTTTTGG 106 | | | ||| || ||||||||| ||||||||| Sbjct 3563 CCGGCACAGTCC--GGCTCATATATTAATCTGATTTTTGG 3526
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
3444
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
3632
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
109.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183505.1

NW_004183505.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22652, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 112.0 bits (102.3), Expect = 9.48E-20 Identities = 64/68 (94%), Gaps = 1/68 (1%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 ||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |||| Sbjct 2897 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTC-TATCAGTTTAATATCTGGTACG 2831
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
2711
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
2892
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
38.61
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Ambiguous base detected in uid:346|NW_004183505.1rc, violating base NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN, pos 131

Hit: NW_004183554.1

NW_004183554.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22603, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 125.0 bits (114.0), Expect = 5.24E-23 Identities = 91/108 (84%), Gaps = 4/108 (4%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct 2712 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTACG 2779 Query 69 TC--CTCTATCCGAGGACAATATATTAAATGGATTTTTGG 106 | | | ||| || ||||||||| ||||||||| Sbjct 2780 CCGGCACAGTCC--GGCTCATATATTAATCTGATTTTTGG 2817
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
2712
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
2900
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
109.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183554.1

NW_004183554.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22603, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 84.0 bits (77.0), Expect = 3.77E-12 Identities = 45/47 (96%), Gaps = 0/47 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTT 47 ||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 376 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTT 422
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
376
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
560
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
28.71
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183554.1

NW_004183554.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22603, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 62.0 bits (57.2), Expect = 3.53E-06 Identities = 58/74 (78%), Gaps = 4/74 (5%) Strand = Plus/Plus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGGATTT 102 |||||||||||||| |||||||||||||| |||| | | | ||| || ||||||||| ||||| Sbjct 43 AGTATCTGTTCTTAACAGTTTAATATCTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCTGATTT 110 Query 103 TTGG 106 |||| Sbjct 111 TTGG 114
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
9
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
197
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
48.36
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

NW_004183554.1: Sequence cannot be extended sufficiently. Missing -21 nt upstream in the genome.

Hit: NW_004183554.1

NW_004183554.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22603, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 46.0 bits (42.8), Expect = 7.79E-02 Identities = 26/28 (93%), Gaps = 0/28 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATC 28 ||||||||||||||| ||||||||||| Sbjct 3079 ATCGCTTCTCGGCCTAATGGCTAAGATC 3106
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
3079
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
3254
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
9.88
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183901.1

NW_004183901.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22251, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 125.0 bits (114.0), Expect = 5.24E-23 Identities = 91/108 (84%), Gaps = 4/108 (4%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACGTC 70 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| | Sbjct 223 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTACGCC 154 Query 71 --CTCTATCCGAGGACAATATATTAAATGGATTTTTGG 106 | | ||| || ||||||||| ||||||||| Sbjct 153 GGCACAGTCC--GGCTCATATATTAATCTGATTTTTGG 118
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
36
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
224
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
109.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183901.1

NW_004183901.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22251, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 90.0 bits (82.4), Expect = 8.88E-14 Identities = 48/50 (96%), Gaps = 0/50 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATC 50 ||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct 839 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATC 790
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
652
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
824
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
29.92
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183901.1

NW_004183901.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22251, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 84.0 bits (77.0), Expect = 3.77E-12 Identities = 45/47 (96%), Gaps = 0/47 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTT 47 ||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 3567 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTT 3521
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
3380
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
3564
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
27.64
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183901.1

NW_004183901.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22251, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 67.0 bits (61.7), Expect = 2.90E-07 Identities = 59/74 (80%), Gaps = 4/74 (5%) Strand = Plus/Minus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGGATTT 102 ||||||||||||||||||||||||||||| |||| | | | ||| || ||||||||| ||||| Sbjct 556 AGTATCTGTTCTTATCAGTTTAATATCTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCTGATTT 489 Query 103 TTGG 106 |||| Sbjct 488 TTGG 485
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
401
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
591
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
55.99
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183901.1

NW_004183901.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22251, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 67.0 bits (61.7), Expect = 2.90E-07 Identities = 59/74 (80%), Gaps = 4/74 (5%) Strand = Plus/Minus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGGAT 100 ||||||||||||||||||||||||||||| |||| | | | ||| || ||||||||| ||| Sbjct 1172 AGTATCTGTTCTTATCAGTTTAATATCTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCTGAT 1107 Query 101 TTTTGG 106 |||||| Sbjct 1106 TTTTGG 1101
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
1019
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1207
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
54.08
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004184206.1

NW_004184206.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_21936, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 125.0 bits (114.0), Expect = 5.24E-23 Identities = 91/108 (84%), Gaps = 4/108 (4%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACGTC 70 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| | Sbjct 535 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTACGCC 466 Query 71 --CTCTATCCGAGGACAATATATTAAATGGATTTTTGG 106 | | ||| || ||||||||| ||||||||| Sbjct 465 GGCACAGTCC--GGCTCATATATTAATCTGATTTTTGG 430
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
348
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
536
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
109.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004184206.1

NW_004184206.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_21936, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 84.0 bits (77.0), Expect = 3.77E-12 Identities = 45/47 (96%), Gaps = 0/47 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTT 47 ||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 168 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTT 122
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
31
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
198
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
30.43
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

NW_004184206.1: Sequence cannot be extended sufficiently by unaligned portion of query. THIS IS PROBABLY FRAGMENT! Trimmed upstream.
NW_004184206.1: Sequence cannot be extended sufficiently. Missing -49 nt upstream in the genome.

Hit: NW_004184206.1

NW_004184206.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_21936, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 84.0 bits (77.0), Expect = 3.77E-12 Identities = 45/47 (96%), Gaps = 0/47 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTT 47 ||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 2758 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTT 2712
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
2571
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
2751
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
27.95
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004184206.1

NW_004184206.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_21936, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 67.0 bits (61.7), Expect = 2.90E-07 Identities = 59/74 (80%), Gaps = 4/74 (5%) Strand = Plus/Minus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGGATTT 102 ||||||||||||||||||||||||||||| |||| | | | ||| || ||||||||| ||||| Sbjct 868 AGTATCTGTTCTTATCAGTTTAATATCTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCTGATTT 801 Query 103 TTGG 106 |||| Sbjct 800 TTGG 797
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
716
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
903
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
56.38
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004184206.1

NW_004184206.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_21936, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 67.0 bits (61.7), Expect = 2.90E-07 Identities = 59/74 (80%), Gaps = 4/74 (5%) Strand = Plus/Minus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGGAT 100 ||||||||||||||||||||||||||||| |||| | | | ||| || ||||||||| ||| Sbjct 3091 AGTATCTGTTCTTATCAGTTTAATATCTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCTGAT 3026 Query 101 TTTTGG 106 |||||| Sbjct 3025 TTTTGG 3020
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
2938
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
3126
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
56.0
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004184833.1

NW_004184833.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_21299, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 125.0 bits (114.0), Expect = 5.24E-23 Identities = 91/108 (84%), Gaps = 4/108 (4%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACGTC 70 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| | Sbjct 91 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTACGCC 160 Query 71 --CTCTATCCGAGGACAATATATTAAATGGATTTTTGG 106 | | ||| || ||||||||| ||||||||| Sbjct 161 GGCACAGTCC--GGCTCATATATTAATCTGATTTTTGG 196
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
91
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
279
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
109.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004184833.1

NW_004184833.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_21299, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 125.0 bits (114.0), Expect = 5.24E-23 Identities = 91/108 (84%), Gaps = 4/108 (4%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACGTC 70 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| | Sbjct 458 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTACGCC 527 Query 71 --CTCTATCCGAGGACAATATATTAAATGGATTTTTGG 106 | | ||| || ||||||||| ||||||||| Sbjct 528 GGCACAGTCC--GGCTCATATATTAATCTGATTTTTGG 563
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
458
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
646
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
109.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004184833.1

NW_004184833.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_21299, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 84.0 bits (77.0), Expect = 3.77E-12 Identities = 45/47 (96%), Gaps = 0/47 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTT 47 ||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 825 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTT 871
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
825
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1003
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
25.42
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004184833.1

NW_004184833.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_21299, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 67.0 bits (61.7), Expect = 2.90E-07 Identities = 59/74 (80%), Gaps = 4/74 (5%) Strand = Plus/Plus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGGAT 100 ||||||||||||||||||||||||||||| |||| | | | ||| || ||||||||| ||| Sbjct 2720 AGTATCTGTTCTTATCAGTTTAATATCTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCTGAT 2785 Query 101 TTTTGG 106 |||||| Sbjct 2786 TTTTGG 2791
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
2686
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
2874
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
56.11
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004186552.1

NW_004186552.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_19535, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 125.0 bits (114.0), Expect = 5.24E-23 Identities = 91/108 (84%), Gaps = 4/108 (4%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACGTC 70 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| | Sbjct 152 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTACGCC 221 Query 71 --CTCTATCCGAGGACAATATATTAAATGGATTTTTGG 106 | | ||| || ||||||||| ||||||||| Sbjct 222 GGCACAGTCC--GGCTCATATATTAATCTGATTTTTGG 257
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
152
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
340
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
109.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004186552.1

NW_004186552.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_19535, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 81.0 bits (74.3), Expect = 4.60E-11 Identities = 45/48 (94%), Gaps = 0/48 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTA 48 ||||||||||||||| |||||||||||||||||||||||| |||||| Sbjct 519 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTTTTCTTA 566
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
519
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
710
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
29.06
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004187056.1

NW_004187056.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_19010, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 125.0 bits (114.0), Expect = 5.24E-23 Identities = 91/108 (84%), Gaps = 4/108 (4%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACGTC 70 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| | Sbjct 824 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTACGCC 893 Query 71 --CTCTATCCGAGGACAATATATTAAATGGATTTTTGG 106 | | ||| || ||||||||| ||||||||| Sbjct 894 GGCACAGTCC--GGCTCATATATTAATCTGATTTTTGG 929
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
824
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1012
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
109.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004187056.1

NW_004187056.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_19010, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 82.0 bits (75.2), Expect = 1.32E-11 Identities = 44/46 (96%), Gaps = 0/46 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCT 46 ||||||||||||||| ||||||||||||||||||||||||||||| Sbjct 1191 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCT 1236
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
1191
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1388
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
33.12
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004187056.1

NW_004187056.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_19010, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 67.0 bits (61.7), Expect = 2.90E-07 Identities = 59/74 (80%), Gaps = 4/74 (5%) Strand = Plus/Plus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGGATTT 102 ||||||||||||||||||||||||||||| |||| | | | ||| || ||||||||| ||||| Sbjct 491 AGTATCTGTTCTTATCAGTTTAATATCTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCTGATTT 558 Query 103 TTGG 106 |||| Sbjct 559 TTGG 562
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
458
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
645
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
57.49
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004171923.1

NW_004171923.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_34279, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 121.0 bits (110.4), Expect = 6.39E-22 Identities = 65/68 (96%), Gaps = 0/68 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATA 66 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || Sbjct 48242 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTA 48177 Query 67 CG 68 || Sbjct 48176 CG 48175
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
48055
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
48238
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
90.06
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004171923.1

NW_004171923.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_34279, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 79.0 bits (72.5), Expect = 1.60E-10 Identities = 44/47 (94%), Gaps = 0/47 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTT 47 || |||||||||||| |||||||||||||||||||||||||||||| Sbjct 12877 ATTGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTT 12831
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
12690
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
12880
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
22.02
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004171923.1

NW_004171923.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_34279, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 63.0 bits (58.1), Expect = 3.53E-06 Identities = 33/34 (97%), Gaps = 0/34 (0%) Strand = Plus/Minus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 ||||||||||||||||||||||||||||| |||| Sbjct 38703 AGTATCTGTTCTTATCAGTTTAATATCTGGTACG 38670
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
38550
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
38738
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
33.11
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004171923.1

NW_004171923.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_34279, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 63.0 bits (58.1), Expect = 3.53E-06 Identities = 33/34 (97%), Gaps = 0/34 (0%) Strand = Plus/Minus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 ||||||||||||||||||||||||||||| |||| Sbjct 43885 AGTATCTGTTCTTATCAGTTTAATATCTGGTACG 43852
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
43734
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
43920
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
24.74
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004171923.1

NW_004171923.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_34279, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 59.0 bits (54.5), Expect = 4.31E-05 Identities = 55/70 (79%), Gaps = 4/70 (6%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGGATT 101 ||||||||||||||||||||||||||| ||| | | | ||| || ||||||||| |||| Sbjct 18843 ATCTGTTCTTATCAGTTTAATATCTGAAACGCCGGCACAGTCC--GGCTCATATATTAATCTGATT 18780 Query 102 TTTG 105 |||| Sbjct 18779 TTTG 18776
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
18693
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
18881
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
27.74
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004171923.1

NW_004171923.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_34279, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 58.0 bits (53.6), Expect = 4.31E-05 Identities = 32/34 (94%), Gaps = 0/34 (0%) Strand = Plus/Minus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 ||| ||||||||||||||||||||||||| |||| Sbjct 12542 AGTGTCTGTTCTTATCAGTTTAATATCTGGTACG 12509
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
12389
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
12577
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
26.81
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004171923.1

NW_004171923.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_34279, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 57.0 bits (52.7), Expect = 1.50E-04 Identities = 30/31 (97%), Gaps = 0/31 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAG 31 |||||||||||||||| |||||||||||||| Sbjct 12209 ATCGCTTCTCGGCCTTATGGCTAAGATCAAG 12179
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
12022
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
12212
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
16.22
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004171923.1

NW_004171923.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_34279, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 57.0 bits (52.7), Expect = 1.50E-04 Identities = 30/31 (97%), Gaps = 0/31 (0%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG 68 |||||||||||||||||||||||||| |||| Sbjct 13206 ATCTGTTCTTATCAGTTTAATATCTGGTACG 13176
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
13055
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
13243
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
45.85
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004171923.1

NW_004171923.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_34279, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 57.0 bits (52.7), Expect = 1.50E-04 Identities = 57/74 (77%), Gaps = 4/74 (5%) Strand = Plus/Minus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGG 98 |||||||||| ||||||||||||||||| |||| | | | ||| || ||||||||| | Sbjct 28820 AGTATCTGTTTATATCAGTTTAATATCTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCTG 28757 Query 99 ATTTTTGG 106 |||||||| Sbjct 28756 ATTTTTGG 28749
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
28668
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
28855
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
26.9
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004171923.1

NW_004171923.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_34279, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 56.0 bits (51.8), Expect = 1.50E-04 Identities = 28/28 (100%), Gaps = 0/28 (0%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGAT 65 |||||||||||||||||||||||||||| Sbjct 48745 ATCTGTTCTTATCAGTTTAATATCTGAT 48718
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
48596
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
48777
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-20.57
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004171923.1

NW_004171923.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_34279, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 47.0 bits (43.7), Expect = 7.79E-02 Identities = 28/31 (90%), Gaps = 0/31 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAG 31 ||||| ||||||||| |||||||||||||| Sbjct 18513 ATCGCGTCTCGGCCTAATGGCTAAGATCAAG 18483
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
18326
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
18519
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
10.04
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004171923.1

NW_004171923.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_34279, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 47.0 bits (43.7), Expect = 7.79E-02 Identities = 34/41 (83%), Gaps = 0/41 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCT 41 ||||||||||||||| ||||||||||| | ||||||| Sbjct 28493 ATCGCTTCTCGGCCTAATGGCTAAGATCTTTAGGAGTATCT 28453
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
28306
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
28506
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-1.8
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004171923.1

NW_004171923.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_34279, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 46.0 bits (42.8), Expect = 7.79E-02 Identities = 26/28 (93%), Gaps = 0/28 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATC 28 ||||||||||||||| ||||||||||| Sbjct 38376 ATCGCTTCTCGGCCTAATGGCTAAGATC 38349
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
38189
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
38382
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
10.13
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004171923.1

NW_004171923.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_34279, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 41.0 bits (38.3), Expect = 3.31E+00 Identities = 25/28 (89%), Gaps = 0/28 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATC 28 ||||||||||||||| || |||||||| Sbjct 43550 ATCGCTTCTCGGCCTAATGCCTAAGATC 43523
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
43363
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
43558
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-2.5700000000000003
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021127691.1

NW_021127691.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xfSc0000321, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 112.0 bits (102.3), Expect = 9.48E-20 Identities = 112/148 (76%), Gaps = 1/148 (1%) Strand = Plus/Plus Query 27 TCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATAT 91 |||||||||||||||||||||||||| ||||||||||||||| | ||| | | | |||||| Sbjct 25045 TCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATACGCTGCTCATTGAGCAGCTCATATAT 25110 Query 92 TAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTG 157 |||| |||||||||| | ||| ||||| || |||||| |||| ||||| | | | | Sbjct 25111 TAAACTGATTTTTGGAACCGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGCCTCG 25176 Query 158 GTATTGCAGTACCTCC 173 |||| ||| ||||||| Sbjct 25177 GTATAGCACTACCTCC 25192
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
25016
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
25207
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
113.1
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Ambiguous base detected in uid:384|NW_021127691.1fw, violating base N, pos 28

Hit: NW_021127691.1

NW_021127691.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xfSc0000321, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 90.0 bits (82.4), Expect = 8.88E-14 Identities = 101/137 (74%), Gaps = 1/137 (1%) Strand = Plus/Plus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTT 104 ||||||||||||||| ||||||||||||||| | ||| | | | |||||||||| ||||||| Sbjct 5687 ATCTGTTCTTATCAGCTTAATATCTGATACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTT 5754 Query 105 GGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTC 172 ||| | ||| ||||| || |||||| |||| ||||| | | | ||||| ||| |||||| Sbjct 5755 GGAACCGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTC 5822 Query 173 C 173 | Sbjct 5823 C 5823
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
5647
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
5838
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
107.34
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021127691.1

NW_021127691.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xfSc0000321, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 90.0 bits (82.4), Expect = 8.88E-14 Identities = 101/137 (74%), Gaps = 1/137 (1%) Strand = Plus/Plus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGATTT 102 ||||||||||||||| ||||||||||||||| | ||| | | | |||||||||| ||||| Sbjct 12605 ATCTGTTCTTATCAGCTTAATATCTGATACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTT 12670 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTA 168 ||||| | ||| ||||| || |||||| |||| ||||| | | | ||||| ||| || Sbjct 12671 TTGGAACCGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTA 12736 Query 169 CCTCC 173 ||||| Sbjct 12737 CCTCC 12741
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
12572
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
12756
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
103.76
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021127691.1

NW_021127691.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xfSc0000321, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 90.0 bits (82.4), Expect = 8.88E-14 Identities = 101/137 (74%), Gaps = 1/137 (1%) Strand = Plus/Plus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGATTT 102 ||||||||||||||| ||||||||||||||| | ||| | | | |||||||||| ||||| Sbjct 39724 ATCTGTTCTTATCAGCTTAATATCTGATACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTT 39789 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTA 168 ||||| | ||| ||||| || |||||| |||| ||||| | | | ||||| ||| || Sbjct 39790 TTGGAACCGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTA 39855 Query 169 CCTCC 173 ||||| Sbjct 39856 CCTCC 39860
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
39686
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
39875
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
70.72
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Ambiguous base detected in uid:387|NW_021127691.1fw, violating base NNNNNNNNNN, pos 180

Hit: NW_021127691.1

NW_021127691.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xfSc0000321, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 51.0 bits (47.3), Expect = 6.39E-03 Identities = 27/28 (96%), Gaps = 0/28 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATC 28 ||||||||||||||||||||||||| || Sbjct 19800 ATCGCTTCTCGGCCTTTTGGCTAAGTTC 19827
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
19800
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
19997
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-2.7
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021127691.1

NW_021127691.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xfSc0000321, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 51.0 bits (47.3), Expect = 6.39E-03 Identities = 27/28 (96%), Gaps = 0/28 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATC 28 ||||||||||||||||||||||||| || Sbjct 33311 ATCGCTTCTCGGCCTTTTGGCTAAGGTC 33338
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
33311
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
33496
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
4.29
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021127691.1

NW_021127691.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xfSc0000321, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 47.0 bits (43.7), Expect = 7.79E-02 Identities = 28/31 (90%), Gaps = 0/31 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAG 31 ||||||||| ||||||||||||||| || || Sbjct 7349 ATCGCTTCTTGGCCTTTTGGCTAAGTTCCAG 7379
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
7349
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
7542
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
0.43
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163239.1

NW_021163239.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000229F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 111.0 bits (101.4), Expect = 3.31E-19 Identities = 57/58 (98%), Gaps = 0/58 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAAT 58 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct 42518 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAAT 42575
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
42518
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
42703
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
40.67
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163239.1

NW_021163239.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000229F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 96.0 bits (87.8), Expect = 2.09E-15 Identities = 114/154 (74%), Gaps = 3/154 (2%) Strand = Plus/Plus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACA 85 ||||||||||||||||||||||||||||||| ||||||||||||| | | | || || | | Sbjct 30208 TAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC- 30272 Query 86 ATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATC 151 |||||||||| ||||||||| || ||| || | |||||||| | || ||||| | Sbjct 30273 ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTT 30338 Query 152 GACCTGGTATTGCAGTACCTCC 173 | | ||||||||| ||| ||| Sbjct 30339 GTCTCGGTATTGCACTACATCC 30360
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
30185
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
30375
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
83.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163239.1

NW_021163239.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000229F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 86.0 bits (78.8), Expect = 1.08E-12 Identities = 112/154 (73%), Gaps = 3/154 (2%) Strand = Plus/Plus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACA 85 |||||||||||||||||||||||||||||| ||||||||||||| | | | || || | | Sbjct 68234 TAAGATCAAGTGTAGTATCTGTTCTTATCACCTTAATATCTGATATGTTAGGCAATGCCTAACTC- 68298 Query 86 ATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATC 151 |||||||||| ||||||||| || ||| || | |||||||| || ||| | | Sbjct 68299 ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCCCCCTGGCCATGGGTT 68364 Query 152 GACCTGGTATTGCAGTACCTCC 173 | | |||||||||| ||| ||| Sbjct 68365 GTCTTGGTATTGCACTACATCC 68386
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
68213
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
68401
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
67.59
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163239.1

NW_021163239.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000229F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 69.0 bits (63.5), Expect = 8.31E-08 Identities = 36/37 (97%), Gaps = 0/37 (0%) Strand = Plus/Plus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAAT 58 ||||||||||||||||||||||||||||||| ||||| Sbjct 64321 TAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAAT 64357
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
64298
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
64485
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-7.67
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163239.1

NW_021163239.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000229F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 64.0 bits (59.0), Expect = 1.01E-06 Identities = 98/138 (71%), Gaps = 3/138 (2%) Strand = Plus/Plus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAATATATTAAATGGATT 101 ||||||||||||||| ||||||||||||| | | | || || | | |||||||||| |||| Sbjct 46963 ATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-ATATATTAAACTGATT 47027 Query 102 TTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGT 167 ||||| || ||| || | |||||||| | || ||||| | | | ||||||||| | Sbjct 47028 TTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACT 47093 Query 168 ACCTCC 173 || ||| Sbjct 47094 ACATCC 47099
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
46926
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
47114
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
80.25
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163239.1

NW_021163239.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000229F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 57.0 bits (52.7), Expect = 1.50E-04 Identities = 96/137 (70%), Gaps = 3/137 (2%) Strand = Plus/Plus Query 39 TCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTT 102 ||||||||||| || ||||||||||||| | | | || || | | |||||||||| ||||| Sbjct 41043 TCTGTTCTTATTAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTT 41107 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTA 168 |||| || ||| || | |||||||| | || ||||| | | | ||||||||| || Sbjct 41108 TTGGCCTTCGGCTTTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTA 41173 Query 169 CCTCC 173 | ||| Sbjct 41174 CATCC 41178
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
41007
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
41193
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
76.04
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163239.1

NW_021163239.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000229F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 52.0 bits (48.2), Expect = 1.83E-03 Identities = 26/26 (100%), Gaps = 0/26 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGA 26 |||||||||||||||||||||||||| Sbjct 69732 ATCGCTTCTCGGCCTTTTGGCTAAGA 69757
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
69732
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
69922
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-0.97
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163239.1

NW_021163239.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000229F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 50.0 bits (46.4), Expect = 6.39E-03 Identities = 25/25 (100%), Gaps = 0/25 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 ||||||||||||||||||||||||| Sbjct 54478 ATCGCTTCTCGGCCTTTTGGCTAAG 54502
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
54478
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
54649
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-0.47000000000000003
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_019218988.1

NW_019218988.1 Stylophora pistillata isolate CSM Monaco unplaced genomic scaffold, Stylophora pistillata v1 Spis.scaffold1205, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 110.0 bits (100.5), Expect = 3.31E-19 Identities = 61/65 (94%), Gaps = 0/65 (0%) Strand = Plus/Plus Query 4 GCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 ||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| | |||||| Sbjct 8890 GCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTTTTATCAGCTTAATACCCGATACG 8954
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
8887
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
9066
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
29.57
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_001828859.1

NW_001828859.1 Nematostella vectensis NEMVEscaffold_6083 genomic scaffold, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 100.0 bits (91.5), Expect = 1.71E-16 Identities = 50/50 (100%), Gaps = 0/50 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATC 50 |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 349 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATC 398
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
349
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
533
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
38.58
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_001828859.1

NW_001828859.1 Nematostella vectensis NEMVEscaffold_6083 genomic scaffold, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 94.0 bits (86.0), Expect = 7.29E-15 Identities = 105/141 (74%), Gaps = 2/141 (1%) Strand = Plus/Plus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGATT 101 |||||||||||||||||| ||||||||||||||| | ||| | | | |||||||||| |||| Sbjct 6119 AGTATCTGTTCTTATCAGCTTAATATCTGATACGCTGCTCATTGAGTAGCTCATATATTAAACTGATT 6186 Query 102 TTTGGAGCAGGGAGATGGAAT-AGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTA 168 |||||| || |||||| || ||||||| |||| ||||| | | | ||||||||| || Sbjct 6187 TTTGGAAACTGGCTGTGGAATAAGCGGCTTGCTGCGTCCCAGCCACGGGTTGTCTCGGTATTGCACTA 6254 Query 169 CCTCC 173 ||||| Sbjct 6255 CCTCC 6259
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
6081
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
6274
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
83.66
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_001833487.1

NW_001833487.1 Nematostella vectensis NEMVEscaffold_927 genomic scaffold, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 100.0 bits (91.5), Expect = 1.71E-16 Identities = 50/50 (100%), Gaps = 0/50 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATC 50 |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7648 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATC 7599
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
7461
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
7645
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
38.57
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Ambiguous base detected in uid:402|NW_001833487.1rc, violating base N, pos 132

Hit: NW_001833487.1

NW_001833487.1 Nematostella vectensis NEMVEscaffold_927 genomic scaffold, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 100.0 bits (91.5), Expect = 1.71E-16 Identities = 50/50 (100%), Gaps = 0/50 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATC 50 |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 9226 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATC 9177
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
9039
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
9223
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
38.58
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_001833487.1

NW_001833487.1 Nematostella vectensis NEMVEscaffold_927 genomic scaffold, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 83.0 bits (76.1), Expect = 1.32E-11 Identities = 106/144 (74%), Gaps = 5/144 (3%) Strand = Plus/Minus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGATT 101 |||||||||||||||||| ||||||||||||||| | ||| | | | |||||||||| |||| Sbjct 1508 AGTATCTGTTCTTATCAGCTTAATATCTGATACGCTGCTCATTGAGTAGCTCATATATTAAACTGATT 1441 Query 102 TTTGG-AGCAGGGAGATGGAATA--GGAGCTTGCTCTGTCCAC-TCCACGCATCGACCTGGTATTGCA 165 ||||| | | || ||||||| | ||||||| |||| | ||||| | | | ||||||||| Sbjct 1440 TTTGGAAACTGGCCTGTGGAATAAGCGGGCTTGCTGCGTCCCCAGCCACGGGTGGTCTCGGTATTGCA 1373 Query 166 GTACCTCC 173 ||| ||| Sbjct 1372 CTACTTCC 1365
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
1349
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1542
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
73.22
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_001833042.1

NW_001833042.1 Nematostella vectensis NEMVEscaffold_1464 genomic scaffold, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 100.0 bits (91.5), Expect = 1.71E-16 Identities = 50/50 (100%), Gaps = 0/50 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATC 50 |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 17637 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATC 17686
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
17637
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
17821
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
39.84
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_018384183.1

NW_018384183.1 Exaiptasia pallida isolate CC7 unplaced genomic scaffold, Aiptasia genome 1.1 scaffold1072, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 98.0 bits (89.7), Expect = 5.98E-16 Identities = 106/139 (76%), Gaps = 5/139 (4%) Strand = Plus/Plus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAG--GACAATATATTAAATGGATTT 102 ||||||||||||||| ||||||||||||||| | ||| || |||| | |||||||||| ||||| Sbjct 4131 ATCTGTTCTTATCAGCTTAATATCTGATACGCTGCTC-AT-CGAGTAGCTCATATATTAAACTGATTT 4196 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACC 170 ||||| | ||| ||||| || |||||| |||| ||||| | | | ||||||||| |||| Sbjct 4197 TTGGAACTGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGTCTCGGTATTGCACTACC 4264 Query 171 TCC 173 ||| Sbjct 4265 TCC 4267
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
4086
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
4282
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
106.34
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_018384183.1

NW_018384183.1 Exaiptasia pallida isolate CC7 unplaced genomic scaffold, Aiptasia genome 1.1 scaffold1072, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 98.0 bits (89.7), Expect = 5.98E-16 Identities = 106/139 (76%), Gaps = 5/139 (4%) Strand = Plus/Plus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAG--GACAATATATTAAATGGATTT 102 ||||||||||||||| ||||||||||||||| | ||| || |||| | |||||||||| ||||| Sbjct 6666 ATCTGTTCTTATCAGCTTAATATCTGATACGCTGCTC-AT-CGAGTAGCTCATATATTAAACTGATTT 6731 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACC 170 ||||| | ||| ||||| || |||||| |||| ||||| | | | ||||||||| |||| Sbjct 6732 TTGGAACTGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGTCTCGGTATTGCACTACC 6799 Query 171 TCC 173 ||| Sbjct 6800 TCC 6802
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
6624
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
6817
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
106.11
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_018384183.1

NW_018384183.1 Exaiptasia pallida isolate CC7 unplaced genomic scaffold, Aiptasia genome 1.1 scaffold1072, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 50.0 bits (46.4), Expect = 6.39E-03 Identities = 25/25 (100%), Gaps = 0/25 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 ||||||||||||||||||||||||| Sbjct 2286 ATCGCTTCTCGGCCTTTTGGCTAAG 2310
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
2286
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
2478
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-0.8
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_018388279.1

NW_018388279.1 Exaiptasia pallida isolate CC7 unplaced genomic scaffold, Aiptasia genome 1.1 scaffold879, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 98.0 bits (89.7), Expect = 5.98E-16 Identities = 106/139 (76%), Gaps = 5/139 (4%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAG--GACAATATATTAAATGGATTTTT 104 ||||||||||||||| ||||||||||||||| | ||| || |||| | |||||||||| ||||||| Sbjct 183 ATCTGTTCTTATCAGCTTAATATCTGATACGCTGCTC-AT-CGAGTAGCTCATATATTAAACTGATTTTT 116 Query 105 GGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 ||| | ||| ||||| || |||||| |||| ||||| | | | ||||||||| ||||||| Sbjct 115 GGAACTGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGTCTCGGTATTGCACTACCTCC 47
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
31
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
220
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
105.92
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163346.1

NW_021163346.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000336F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 96.0 bits (87.8), Expect = 2.09E-15 Identities = 114/154 (74%), Gaps = 3/154 (2%) Strand = Plus/Minus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGA 83 ||||||||||||||||||||||||||||||| ||||||||||||| | | | || || | Sbjct 103343 TAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACT 103280 Query 84 CAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACG 147 | |||||||||| ||||||||| || ||| || | |||||||| | || ||||| Sbjct 103279 C-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACG 103217 Query 148 CATCGACCTGGTATTGCAGTACCTCC 173 | | | ||||||||| ||| ||| Sbjct 103216 GGTTGTCTCGGTATTGCACTACATCC 103191
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
103174
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
103364
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
83.96
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163346.1

NW_021163346.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000336F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 96.0 bits (87.8), Expect = 2.09E-15 Identities = 114/154 (74%), Gaps = 3/154 (2%) Strand = Plus/Minus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGA 83 ||||||||||||||||||||||||||||||| ||||||||||||| | | | || || | Sbjct 111240 TAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACT 111177 Query 84 CAATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACG 147 | |||||||||| ||||||||| || ||| || | | |||||| | || ||||| Sbjct 111176 C-ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAACCTTGCTTCGCCCTGGCCACG 111114 Query 148 CATCGACCTGGTATTGCAGTACCTCC 173 | | | ||||||||||||| ||| Sbjct 111113 GGTTGTCTCGGTATTGCAGTACATCC 111088
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
111073
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
111261
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
74.18
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163346.1

NW_021163346.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000336F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 74.0 bits (68.0), Expect = 1.96E-09 Identities = 37/37 (100%), Gaps = 0/37 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGT 37 ||||||||||||||||||||||||||||||||||||| Sbjct 59702 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGT 59666
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
59515
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
59697
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
29.29
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163346.1

NW_021163346.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000336F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 69.0 bits (63.5), Expect = 8.31E-08 Identities = 36/37 (97%), Gaps = 0/37 (0%) Strand = Plus/Minus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAAT 58 ||||||||||||||||||||||||||||||| ||||| Sbjct 53504 TAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAAT 53468
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
53336
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
53526
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-21.26
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163346.1

NW_021163346.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000336F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 69.0 bits (63.5), Expect = 8.31E-08 Identities = 36/37 (97%), Gaps = 0/37 (0%) Strand = Plus/Minus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAAT 58 ||||||||||||||||||||||||||||||| ||||| Sbjct 65259 TAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAAT 65223
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
65093
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
65293
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-13.52
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163346.1

NW_021163346.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000336F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 69.0 bits (63.5), Expect = 8.31E-08 Identities = 36/37 (97%), Gaps = 0/37 (0%) Strand = Plus/Minus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAAT 58 ||||||||||||||||||||||||||||||| ||||| Sbjct 118321 TAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAAT 118285
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
118153
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
118339
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-10.39
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163346.1

NW_021163346.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000336F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 62.0 bits (57.2), Expect = 3.53E-06 Identities = 100/144 (69%), Gaps = 9/144 (6%) Strand = Plus/Minus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTCCTCTATCCGAGG----AC-AATATATTAAA 95 || ||||||||||||||| ||||||||||||| || || | | | || |||||||||| Sbjct 14234 AGAATCTGTTCTTATCAGCTTAATATCTGATATGT----TAGGCAATGCTTAACTCATATATTAAA 14173 Query 96 TGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTAT 161 ||||||||| || ||| || | |||||||| | || ||||| | | | ||||| Sbjct 14172 CTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGTCTCGGTAT 14107 Query 162 TGCAGTACCTCC 173 |||| ||| ||| Sbjct 14106 TGCACTACATCC 14095
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
14082
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
14268
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
75.28
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163346.1

NW_021163346.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000336F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 59.0 bits (54.5), Expect = 4.31E-05 Identities = 100/142 (70%), Gaps = 10/142 (7%) Strand = Plus/Minus Query 39 TCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTT 102 |||||||||||||| ||||||||||||| | | | || || | | |||||||||| ||||| Sbjct 48605 TCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTT 48541 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGCT-----CTGTCCACTCCACGCATCGACCTGGTATTG 163 |||| || ||| || | |||||||| ||| ||| ||||| | | | ||||||| Sbjct 48540 TTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCA--CCACGGGTTGTCTCGGTATTG 48477 Query 164 CAGTACCTCC 173 || ||| ||| Sbjct 48476 CACTACATCC 48467
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
48450
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
48643
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
74.53
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163346.1

NW_021163346.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000336F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 57.0 bits (52.7), Expect = 1.50E-04 Identities = 30/31 (97%), Gaps = 0/31 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAG 31 ||| ||||||||||||||||||||||||||| Sbjct 81802 ATCACTTCTCGGCCTTTTGGCTAAGATCAAG 81772
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
81615
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
81807
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
5.48
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163346.1

NW_021163346.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000336F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 57.0 bits (52.7), Expect = 1.50E-04 Identities = 96/137 (70%), Gaps = 3/137 (2%) Strand = Plus/Minus Query 39 TCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTT 102 |||||||||||||| ||||||||||||| | | | || || | | ||| |||||| ||||| Sbjct 89369 TCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-ATAAATTAAACTGATTT 89305 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTA 168 |||| || ||| || | |||||||| | || ||||| | | | ||||||||| || Sbjct 89304 TTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTA 89239 Query 169 CCTCC 173 | ||| Sbjct 89238 CATCC 89234
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
89221
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
89407
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
74.64
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163346.1

NW_021163346.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000336F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 54.0 bits (50.0), Expect = 5.25E-04 Identities = 27/27 (100%), Gaps = 0/27 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGAT 27 ||||||||||||||||||||||||||| Sbjct 47101 ATCGCTTCTCGGCCTTTTGGCTAAGAT 47075
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
46914
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
47104
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-2.6
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163346.1

NW_021163346.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000336F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 52.0 bits (48.2), Expect = 1.83E-03 Identities = 26/26 (100%), Gaps = 0/26 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGA 26 |||||||||||||||||||||||||| Sbjct 109768 ATCGCTTCTCGGCCTTTTGGCTAAGA 109743
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
109581
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
109770
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
3.27
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163346.1

NW_021163346.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000336F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 48.0 bits (44.6), Expect = 2.23E-02 Identities = 24/24 (100%), Gaps = 0/24 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAA 24 |||||||||||||||||||||||| Sbjct 12791 ATCGCTTCTCGGCCTTTTGGCTAA 12768
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
12604
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
12790
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-10.49
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163346.1

NW_021163346.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000336F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 44.0 bits (41.0), Expect = 2.72E-01 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand = Plus/Minus Query 6 TTCTCGGCCTTTTGGCTAAGAT 27 |||||||||||||||||||||| Sbjct 102715 TTCTCGGCCTTTTGGCTAAGAT 102694
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
102533
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
102706
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-0.7000000000000001
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163411.1

NW_021163411.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000401F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 96.0 bits (87.8), Expect = 2.09E-15 Identities = 114/154 (74%), Gaps = 3/154 (2%) Strand = Plus/Minus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAAT 87 ||||||||||||||||||||||||||||||| ||||||||||||| | | | || || | | || Sbjct 9869 TAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-AT 9803 Query 88 ATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACC 155 |||||||| ||||||||| || ||| || | |||||||| | || ||||| | | | Sbjct 9802 ATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGTCT 9735 Query 156 TGGTATTGCAGTACCTCC 173 ||||||||| ||| ||| Sbjct 9734 CGGTATTGCACTACATCC 9717
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
9700
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
9890
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
90.54
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163411.1

NW_021163411.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000401F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 96.0 bits (87.8), Expect = 2.09E-15 Identities = 114/154 (74%), Gaps = 3/154 (2%) Strand = Plus/Plus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACA 85 ||||||||||||||||||||||||||||||| ||||||||||||| | | | || || | | Sbjct 32599 TAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC- 32663 Query 86 ATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATC 151 |||||||||| ||||||||| || ||| || | |||||||| | || ||||| | Sbjct 32664 ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTT 32729 Query 152 GACCTGGTATTGCAGTACCTCC 173 | | ||||||||| ||| ||| Sbjct 32730 GTCTCGGTATTGCACTACATCC 32751
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
32576
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
32766
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
90.73
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163411.1

NW_021163411.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000401F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 96.0 bits (87.8), Expect = 2.09E-15 Identities = 114/154 (74%), Gaps = 3/154 (2%) Strand = Plus/Plus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACA 85 ||||||||||||||||||||||||||||||| ||||||||||||| | | | || || | | Sbjct 71181 TAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC- 71245 Query 86 ATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATC 151 |||||||||| ||||||||| || ||| || | |||||||| | || ||||| | Sbjct 71246 ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTT 71311 Query 152 GACCTGGTATTGCAGTACCTCC 173 | | ||||||||| ||| ||| Sbjct 71312 GTCTCGGTATTGCACTACATCC 71333
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
71158
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
71348
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
86.68
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163411.1

NW_021163411.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000401F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 94.0 bits (86.0), Expect = 7.29E-15 Identities = 113/153 (74%), Gaps = 3/153 (2%) Strand = Plus/Plus Query 23 AAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAA 86 |||||||||||||||||||||||||||||| ||||||||||||| | | | || || | | | Sbjct 41979 AAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-A 42043 Query 87 TATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCG 152 ||||||||| ||||||||| || ||| || | |||||||| | || ||||| | | Sbjct 42044 TATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGACCACGGGTTG 42109 Query 153 ACCTGGTATTGCAGTACCTCC 173 | ||||||||| ||| ||| Sbjct 42110 TCTCGGTATTGCACTACATCC 42130
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
41959
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
42145
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
82.61
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163411.1

NW_021163411.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000401F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 92.0 bits (84.2), Expect = 2.54E-14 Identities = 112/152 (74%), Gaps = 3/152 (2%) Strand = Plus/Plus Query 24 AGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAAT 87 ||||||||||||||||||||||||||||| ||||||||||||| | | | || || | | || Sbjct 63782 AGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-AT 63846 Query 88 ATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGA 153 |||||||| ||||||||| || ||| || | |||||||| | || ||||| | | Sbjct 63847 ATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGT 63912 Query 154 CCTGGTATTGCAGTACCTCC 173 | ||||||||| ||| ||| Sbjct 63913 CTCGGTATTGCACTACATCC 63932
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
63757
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
63947
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
83.24
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163411.1

NW_021163411.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000401F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 70.0 bits (64.4), Expect = 2.38E-08 Identities = 101/141 (72%), Gaps = 3/141 (2%) Strand = Plus/Minus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAATATATTAAATGGAT 100 |||||||||||||||||| ||||||||||||| | | | || || | | |||||||||| ||| Sbjct 3619 AGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-ATATATTAAACTGAT 3553 Query 101 TTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTA 168 |||||| || ||| || | |||||||| | || ||||| | | | ||||||||| || Sbjct 3552 TTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTA 3485 Query 169 CCTCC 173 | ||| Sbjct 3484 CATCC 3480
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
3464
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
3653
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
85.17
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163411.1

NW_021163411.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000401F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 62.0 bits (57.2), Expect = 3.53E-06 Identities = 97/137 (71%), Gaps = 3/137 (2%) Strand = Plus/Minus Query 39 TCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTT 102 |||||||||||||| ||||||||||||| | | | || || | | |||||||||| ||||| Sbjct 17524 TCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTT 17460 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTA 168 |||| || ||| || | |||||||| | || ||||| | | | ||||||||| || Sbjct 17459 TTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTA 17394 Query 169 CCTCC 173 | ||| Sbjct 17393 CATCC 17389
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
17371
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
17562
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
87.37
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163411.1

NW_021163411.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000401F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 62.0 bits (57.2), Expect = 3.53E-06 Identities = 97/137 (71%), Gaps = 3/137 (2%) Strand = Plus/Minus Query 39 TCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTT 102 |||||||||||||| ||||||||||||| | | | || || | | |||||||||| ||||| Sbjct 23846 TCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTT 23782 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTA 168 |||| || ||| || | |||||||| | || ||||| | | | ||||||||| || Sbjct 23781 TTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGTCTCGGTATTGCACTA 23716 Query 169 CCTCC 173 | ||| Sbjct 23715 CATCC 23711
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
23693
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
23884
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
84.65
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163411.1

NW_021163411.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000401F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 61.0 bits (56.3), Expect = 1.23E-05 Identities = 32/33 (97%), Gaps = 0/33 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTG 33 ||||||||||||||||| ||||||||||||||| Sbjct 34052 ATCGCTTCTCGGCCTTTGGGCTAAGATCAAGTG 34084
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
34052
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
34246
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
17.84
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163411.1

NW_021163411.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000401F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 56.0 bits (51.8), Expect = 1.50E-04 Identities = 28/28 (100%), Gaps = 0/28 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATC 28 |||||||||||||||||||||||||||| Sbjct 16055 ATCGCTTCTCGGCCTTTTGGCTAAGATC 16028
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
15868
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
16068
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
2.09
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163411.1

NW_021163411.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000401F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 54.0 bits (50.0), Expect = 5.25E-04 Identities = 30/32 (94%), Gaps = 0/32 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGT 32 |||||||||||||||||||||||||| |||| Sbjct 22389 ATCGCTTCTCGGCCTTTTGGCTAAGACGAAGT 22358
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
22202
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
22386
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
8.85
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163411.1

NW_021163411.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000401F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 54.0 bits (50.0), Expect = 5.25E-04 Identities = 27/27 (100%), Gaps = 0/27 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGAT 27 ||||||||||||||||||||||||||| Sbjct 43431 ATCGCTTCTCGGCCTTTTGGCTAAGAT 43457
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
43431
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
43602
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
6.8100000000000005
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163411.1

NW_021163411.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000401F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 52.0 bits (48.2), Expect = 1.83E-03 Identities = 26/26 (100%), Gaps = 0/26 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGA 26 |||||||||||||||||||||||||| Sbjct 2154 ATCGCTTCTCGGCCTTTTGGCTAAGA 2129
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
1967
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
2151
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-0.56
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163411.1

NW_021163411.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000401F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 52.0 bits (48.2), Expect = 1.83E-03 Identities = 26/26 (100%), Gaps = 0/26 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGA 26 |||||||||||||||||||||||||| Sbjct 26601 ATCGCTTCTCGGCCTTTTGGCTAAGA 26626
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
26601
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
26784
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
4.3
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163411.1

NW_021163411.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000401F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 50.0 bits (46.4), Expect = 6.39E-03 Identities = 25/25 (100%), Gaps = 0/25 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 ||||||||||||||||||||||||| Sbjct 65220 ATCGCTTCTCGGCCTTTTGGCTAAG 65244
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
65220
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
65412
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
4.64
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163411.1

NW_021163411.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000401F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 44.0 bits (41.0), Expect = 2.72E-01 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCT 22 |||||||||||||||||||||| Sbjct 8380 ATCGCTTCTCGGCCTTTTGGCT 8359
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
8193
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
8383
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-8.05
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163441.1

NW_021163441.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000431F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 96.0 bits (87.8), Expect = 2.09E-15 Identities = 114/154 (74%), Gaps = 3/154 (2%) Strand = Plus/Plus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACA 85 ||||||||||||||||||||||||||||||| ||||||||||||| | | | || || | | Sbjct 56163 TAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC- 56227 Query 86 ATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATC 151 |||||||||| ||||||||| || ||| || | |||||||| | || ||||| | Sbjct 56228 ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTT 56293 Query 152 GACCTGGTATTGCAGTACCTCC 173 | | ||||||||| ||| ||| Sbjct 56294 GTCTCGGTATTGCACTACATCC 56315
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
56140
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
56330
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
86.68
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163441.1

NW_021163441.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000431F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 92.0 bits (84.2), Expect = 2.54E-14 Identities = 112/152 (74%), Gaps = 3/152 (2%) Strand = Plus/Plus Query 24 AGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAAT 87 ||||||||||||||||||||||||||||| ||||||||||||| | | | || || | | || Sbjct 48757 AGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-AT 48821 Query 88 ATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGA 153 |||||||| ||||||||| || ||| || | |||||||| | || ||||| | | Sbjct 48822 ATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGT 48887 Query 154 CCTGGTATTGCAGTACCTCC 173 | ||||||||| ||| ||| Sbjct 48888 CTCGGTATTGCACTACATCC 48907
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
48732
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
48922
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
83.24
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163441.1

NW_021163441.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000431F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 50.0 bits (46.4), Expect = 6.39E-03 Identities = 25/25 (100%), Gaps = 0/25 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 ||||||||||||||||||||||||| Sbjct 50191 ATCGCTTCTCGGCCTTTTGGCTAAG 50215
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
50191
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
50383
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
4.64
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163505.1

NW_021163505.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000495F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 96.0 bits (87.8), Expect = 2.09E-15 Identities = 114/154 (74%), Gaps = 3/154 (2%) Strand = Plus/Plus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACA 85 ||||||||||||||||||||||||||||||| ||||||||||||| | | | || || | | Sbjct 14936 TAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC- 15000 Query 86 ATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATC 151 |||||||||| ||||||||| || ||| || | |||||||| | || ||||| | Sbjct 15001 ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTT 15066 Query 152 GACCTGGTATTGCAGTACCTCC 173 | | ||||||||| ||| ||| Sbjct 15067 GTCTCGGTATTGCACTACATCC 15088
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
14913
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
15103
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
86.68
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163505.1

NW_021163505.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000495F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 92.0 bits (84.2), Expect = 2.54E-14 Identities = 112/152 (74%), Gaps = 3/152 (2%) Strand = Plus/Plus Query 24 AGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAATAT 89 ||||||||||||||||||||||||||||| ||||||||||||| | | | || || | | |||| Sbjct 7534 AGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-ATAT 7600 Query 90 ATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTG 157 |||||| ||||||||| || ||| || | |||||||| | || ||||| | | | | Sbjct 7601 ATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGGCCACGGGTTGTCTCG 7668 Query 158 GTATTGCAGTACCTCC 173 |||||||| ||| ||| Sbjct 7669 GTATTGCACTACATCC 7684
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
7509
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
7699
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
83.24
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163505.1

NW_021163505.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000495F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 50.0 bits (46.4), Expect = 6.39E-03 Identities = 25/25 (100%), Gaps = 0/25 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 ||||||||||||||||||||||||| Sbjct 8971 ATCGCTTCTCGGCCTTTTGGCTAAG 8995
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
8971
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
9163
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
7.67
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004167330.1

NW_004167330.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_38888, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 96.0 bits (87.8), Expect = 2.09E-15 Identities = 48/48 (100%), Gaps = 0/48 (0%) Strand = Plus/Plus Query 2 TCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 145417 TCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 145464
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
145416
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
145597
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
29.13
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163388.1

NW_021163388.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000378F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 94.0 bits (86.0), Expect = 7.29E-15 Identities = 113/153 (74%), Gaps = 3/153 (2%) Strand = Plus/Plus Query 22 TAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATAC-GTCCTCTAT-CCGAGGACA 85 ||||||||||||||||||||||||||||||| |||||||||||||| || | || || | | Sbjct 18836 TAAGATCAAGTGTAGTATCTGTTCTTATCAGCTTAATATCTGATACGGTAGGCAATGCCTAACTC- 18900 Query 86 ATATATTAAATGGATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATC 151 |||||||||| ||||||||| || ||| || | |||||||| | || | ||| | Sbjct 18901 ATATATTAAACTGATTTTTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTGCCTACGGGTT 18966 Query 152 GACCTGGTATTGCAGTACCTC 172 | | ||||||||| ||| || Sbjct 18967 GTCTCGGTATTGCACTACATC 18987
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
18813
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
19003
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
66.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163388.1

NW_021163388.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000378F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 59.0 bits (54.5), Expect = 4.31E-05 Identities = 31/32 (97%), Gaps = 0/32 (0%) Strand = Plus/Plus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACGT 69 ||||||||||||||| |||||||||||||||| Sbjct 66568 ATCTGTTCTTATCAGCTTAATATCTGATACGT 66599
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
66530
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
66719
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
61.44
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163388.1

NW_021163388.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000378F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 57.0 bits (52.7), Expect = 1.50E-04 Identities = 96/137 (70%), Gaps = 3/137 (2%) Strand = Plus/Plus Query 39 TCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTAT-CCGAGGACAATATATTAAATGGATTT 102 |||| ||||||||| ||||||||||||| | | | || || | | |||||||||| ||||| Sbjct 82954 TCTGCTCTTATCAGCTTAATATCTGATATGTTAGGCAATGCCTAACTC-ATATATTAAACTGATTT 83018 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTA 168 |||| || ||| || | |||||||| | || ||||| | | | ||||||||| || Sbjct 83019 TTGGCCTTCGGCCCTGGGATTGAAGCTTGCTTCGCCCTAGCCACGGGTTGTCTCGGTATTGCACTA 83084 Query 169 CCTCC 173 | ||| Sbjct 83085 CATCC 83089
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
82913
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
83104
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
69.89
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021163388.1

NW_021163388.1 Dendronephthya gigantea isolate DGI-Jeju-01 unplaced genomic scaffold, DenGig_1.0 000378F, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 52.0 bits (48.2), Expect = 1.83E-03 Identities = 26/26 (100%), Gaps = 0/26 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGA 26 |||||||||||||||||||||||||| Sbjct 49291 ATCGCTTCTCGGCCTTTTGGCTAAGA 49316
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
49291
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
49482
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-0.41000000000000003
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004172937.1

NW_004172937.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_33262, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 93.0 bits (85.1), Expect = 2.54E-14 Identities = 48/49 (98%), Gaps = 0/49 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 |||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 37175 ATCGCTTCTCGGCCTTATGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 37223
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
37175
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
37357
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
33.85
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021129659.1

NW_021129659.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xpSc0004601, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 91.0 bits (83.3), Expect = 8.88E-14 Identities = 103/140 (74%), Gaps = 1/140 (1%) Strand = Plus/Plus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGATT 101 |||||||||||||||||| |||||||||||||| | ||| | | | |||||||||| |||| Sbjct 1701 AGTATCTGTTCTTATCAGCCTAATATCTGATACGCTGCTCATTGAGCAGCTCATATATTAAACTGATT 1768 Query 102 TTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTAC 169 |||||| | ||| ||||| || |||||| |||| ||||| | | | ||||| ||| ||| Sbjct 1769 TTTGGAACCGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTAC 1836 Query 170 CTCC 173 |||| Sbjct 1837 CTCC 1840
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
1663
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1855
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
95.73
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021129659.1

NW_021129659.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xpSc0004601, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 75.0 bits (68.9), Expect = 1.96E-09 Identities = 95/132 (72%), Gaps = 1/132 (1%) Strand = Plus/Plus Query 43 TTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGA 107 || ||||||| ||||||||||||||| | ||| | | | |||||||||| |||||||||| Sbjct 15722 TTTTTATCAGCTTAATATCTGATACGCTGCTCATTGAGCAGTTCATATATTAAACTGATTTTTGGA 15787 Query 108 GCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCC 173 | ||| ||||| || |||||| |||| ||||| | | | ||||| ||| ||||||| Sbjct 15788 ACCGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTCC 15853
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
15682
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
15868
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
87.69
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021129659.1

NW_021129659.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xpSc0004601, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 46.0 bits (42.8), Expect = 7.79E-02 Identities = 23/23 (100%), Gaps = 0/23 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTA 23 ||||||||||||||||||||||| Sbjct 10654 ATCGCTTCTCGGCCTTTTGGCTA 10676
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
10654
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
10847
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-8.41
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004178888.1

NW_004178888.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_27301, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 91.0 bits (83.3), Expect = 8.88E-14 Identities = 47/48 (98%), Gaps = 0/48 (0%) Strand = Plus/Minus Query 2 TCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 |||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct 9487 TCGCTTCTCGGCCTTTTGGCTAAGATAAAGTGTAGTATCTGTTCTTAT 9440
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
9301
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
9475
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
33.56
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183617.1

NW_004183617.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22536, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 91.0 bits (83.3), Expect = 8.88E-14 Identities = 47/48 (98%), Gaps = 0/48 (0%) Strand = Plus/Minus Query 21 CTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 ||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct 3856 CTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGGTACG 3809
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
3659
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
3827
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
52.08
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

NW_004183617.1: Sequence cannot be extended sufficiently by unalined portion of query. THIS IS PROBABLY FRAGMENT! Trimmed downstream.
NW_004183617.1: Sequence cannot be extended sufficiently. Missing nt downstream in the genome.

Hit: NW_004183617.1

NW_004183617.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22536, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 79.0 bits (72.5), Expect = 1.60E-10 Identities = 44/47 (94%), Gaps = 0/47 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTT 47 ||||||||||||||| ||||||||||||||||||||||||||| || Sbjct 3509 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTTTT 3463
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
3322
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
3500
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
25.54
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183617.1

NW_004183617.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22536, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 67.0 bits (61.7), Expect = 2.90E-07 Identities = 59/74 (80%), Gaps = 4/74 (5%) Strand = Plus/Minus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGGAT 100 ||||||||||||||||||||||||||||| |||| | | | ||| || ||||||||| ||| Sbjct 1313 AGTATCTGTTCTTATCAGTTTAATATCTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCTGAT 1248 Query 101 TTTTGG 106 |||||| Sbjct 1247 TTTTGG 1242
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
1160
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1348
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
55.11
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183617.1

NW_004183617.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22536, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 58.0 bits (53.6), Expect = 4.31E-05 Identities = 32/34 (94%), Gaps = 0/34 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGT 34 ||||||||||||||| ||||||||||||||||| Sbjct 980 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGT 947
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
793
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
995
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
16.23
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021127034.1

NW_021127034.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.Sc0000663, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 90.0 bits (82.4), Expect = 8.88E-14 Identities = 101/137 (74%), Gaps = 1/137 (1%) Strand = Plus/Plus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGATTT 102 ||||||||||||||| ||||||||||||||| | ||| | | | |||||||||| ||||| Sbjct 23775 ATCTGTTCTTATCAGCTTAATATCTGATACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTT 23840 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTA 168 ||||| | ||| ||||| || |||||| |||| ||||| | | | ||||| ||| || Sbjct 23841 TTGGAACCGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTA 23906 Query 169 CCTCC 173 ||||| Sbjct 23907 CCTCC 23911
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
23740
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
23926
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
106.94
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021127034.1

NW_021127034.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.Sc0000663, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 72.0 bits (66.2), Expect = 6.82E-09 Identities = 68/88 (77%), Gaps = 1/88 (1%) Strand = Plus/Plus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGATTT 102 ||||||||||||||||||||||| ||||||| | ||| | | | |||||||||| ||||| Sbjct 59807 ATCTGTTCTTATCAGTTTAATATATGATACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTT 59872 Query 103 TTGGAGCAGGGAGATGGAATAG 124 ||| | | |||| ||||| || Sbjct 59873 TTGAAACCGGGATGTGGAAAAG 59894
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
59772
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
59960
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
21.68
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021127034.1

NW_021127034.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.Sc0000663, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 58.0 bits (53.6), Expect = 4.31E-05 Identities = 70/96 (73%), Gaps = 1/96 (1%) Strand = Plus/Plus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGATTT 102 ||||||||||||||| | ||||||||||||| | ||| | | | | |||| ||| ||||| Sbjct 57387 ATCTGTTCTTATCAGCTGAATATCTGATACGCTGCTCATTGAGCAGCTCAGATATCAAACTGATTT 57452 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGC 132 ||||| | || ||||| || |||||| Sbjct 57453 TTGGAACCAGGCTGTGGAAAAGAGGCTTGC 57482
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
57344
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
57538
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
11.79
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Ambiguous base detected in uid:462|NW_021127034.1fw, violating base NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN, pos 144

Hit: NW_021127034.1

NW_021127034.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.Sc0000663, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 49.0 bits (45.5), Expect = 2.23E-02 Identities = 26/27 (96%), Gaps = 0/27 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGAT 27 ||||||||||||||||||||| ||||| Sbjct 36592 ATCGCTTCTCGGCCTTTTGGCCAAGAT 36618
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
36592
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
36794
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
1.35
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021127034.1

NW_021127034.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.Sc0000663, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 45.0 bits (41.9), Expect = 2.72E-01 Identities = 24/25 (96%), Gaps = 0/25 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 |||||||||| |||||||||||||| Sbjct 55992 ATCGCTTCTCAGCCTTTTGGCTAAG 56016
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
55992
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
56175
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
0.12
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021127990.1

NW_021127990.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xfSc0000622, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 90.0 bits (82.4), Expect = 8.88E-14 Identities = 101/137 (74%), Gaps = 1/137 (1%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGATTTTT 104 ||||||||||||||| ||||||||||||||| | ||| | | | |||||||||| ||||||| Sbjct 5386 ATCTGTTCTTATCAGCTTAATATCTGATACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTTTT 5319 Query 105 GGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTC 172 ||| | ||| ||||| || |||||| |||| ||||| | | | ||||| ||| |||||| Sbjct 5318 GGAACCGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTACCTC 5251 Query 173 C 173 | Sbjct 5250 C 5250
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
5237
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
5423
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
105.99
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021127990.1

NW_021127990.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xfSc0000622, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 90.0 bits (82.4), Expect = 8.88E-14 Identities = 101/137 (74%), Gaps = 1/137 (1%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGATTT 102 ||||||||||||||| ||||||||||||||| | ||| | | | |||||||||| ||||| Sbjct 12350 ATCTGTTCTTATCAGCTTAATATCTGATACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTT 12285 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTA 168 ||||| | ||| ||||| || |||||| |||| ||||| | | | ||||| ||| || Sbjct 12284 TTGGAACCGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTA 12219 Query 169 CCTCC 173 ||||| Sbjct 12218 CCTCC 12214
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
12200
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
12387
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
108.11
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021127990.1

NW_021127990.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xfSc0000622, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 90.0 bits (82.4), Expect = 8.88E-14 Identities = 101/137 (74%), Gaps = 1/137 (1%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGATTT 102 ||||||||||||||| ||||||||||||||| | ||| | | | |||||||||| ||||| Sbjct 15612 ATCTGTTCTTATCAGCTTAATATCTGATACGCTGCTCATTGAGCAGCTCATATATTAAACTGATTT 15547 Query 103 TTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGCAGTA 168 ||||| | ||| ||||| || |||||| |||| ||||| | | | ||||| ||| || Sbjct 15546 TTGGAACCGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGCACTA 15481 Query 169 CCTCC 173 ||||| Sbjct 15480 CCTCC 15476
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
15460
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
15649
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
105.74
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021127990.1

NW_021127990.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xfSc0000622, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 52.0 bits (48.2), Expect = 1.83E-03 Identities = 26/26 (100%), Gaps = 0/26 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGA 26 |||||||||||||||||||||||||| Sbjct 13821 ATCGCTTCTCGGCCTTTTGGCTAAGA 13796
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
13634
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
13816
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
6.86
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_021127990.1

NW_021127990.1 Acropora millepora isolate SF001 unplaced genomic scaffold, amil_sf_1.1 amil.xfSc0000622, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 50.0 bits (46.4), Expect = 6.39E-03 Identities = 25/25 (100%), Gaps = 0/25 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAG 25 ||||||||||||||||||||||||| Sbjct 10559 ATCGCTTCTCGGCCTTTTGGCTAAG 10535
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
10372
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
10564
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-8.52
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183561.1

NW_004183561.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22596, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 90.0 bits (82.4), Expect = 8.88E-14 Identities = 48/50 (96%), Gaps = 0/50 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATC 50 ||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct 3589 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATC 3540
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
3402
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
3615
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
29.56
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183561.1

NW_004183561.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22596, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 84.0 bits (77.0), Expect = 3.77E-12 Identities = 45/47 (96%), Gaps = 0/47 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTT 47 ||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 3542 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTT 3496
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
3355
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
3533
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
26.29
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183561.1

NW_004183561.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22596, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 52.0 bits (48.2), Expect = 1.83E-03 Identities = 29/31 (94%), Gaps = 0/31 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAG 31 ||||||||||||||| |||||||||||||| Sbjct 571 ATCGCTTCTCGGCCTAATGGCTAAGATCAAG 541
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
384
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
579
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
10.71
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183896.1

NW_004183896.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22256, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 90.0 bits (82.4), Expect = 8.88E-14 Identities = 48/50 (96%), Gaps = 0/50 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATC 50 ||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct 345 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTATC 394
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
345
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
529
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
36.2
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183896.1

NW_004183896.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22256, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 84.0 bits (77.0), Expect = 3.77E-12 Identities = 45/47 (96%), Gaps = 0/47 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTT 47 ||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 2791 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTT 2837
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
2791
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
2983
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
29.37
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004183896.1

NW_004183896.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22256, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 67.0 bits (61.7), Expect = 2.90E-07 Identities = 59/74 (80%), Gaps = 4/74 (5%) Strand = Plus/Plus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGGATTT 102 ||||||||||||||||||||||||||||| |||| | | | ||| || ||||||||| ||||| Sbjct 12 AGTATCTGTTCTTATCAGTTTAATATCTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCTGATTT 79 Query 103 TTGG 106 |||| Sbjct 80 TTGG 83
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
1
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
166
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
58.0
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

NW_004183896.1: Sequence cannot be extended sufficiently. Missing -52 nt upstream in the genome.
NW_004183896.1: Sequence cannot be extended sufficiently by unaligned portion of query. THIS IS PROBABLY FRAGMENT! Trimmed upstream.

Hit: NW_004183896.1

NW_004183896.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_22256, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 53.0 bits (49.1), Expect = 1.83E-03 Identities = 52/67 (78%), Gaps = 4/67 (6%) Strand = Plus/Plus Query 42 GTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGGATTTTTGG 106 |||||||||||||||||||||| |||| | | | ||| || ||||||||| ||||||||| Sbjct 2465 GTTCTTATCAGTTTAATATCTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCTGATTTTTGG 2529
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
2424
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
2612
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
52.73
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Ambiguous base detected in uid:476|NW_004183896.1fw, violating base NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN, pos 0

Hit: NW_004166877.1

NW_004166877.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_39345, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 88.0 bits (80.6), Expect = 3.10E-13 Identities = 47/49 (96%), Gaps = 0/49 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 ||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 377817 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 377769
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
377630
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
377813
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
37.44
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004166885.1

NW_004166885.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_39336, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 88.0 bits (80.6), Expect = 3.10E-13 Identities = 47/49 (96%), Gaps = 0/49 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 ||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 117617 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 117569
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
117430
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
117612
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
31.85
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004166920.1

NW_004166920.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_39299, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 88.0 bits (80.6), Expect = 3.10E-13 Identities = 47/49 (96%), Gaps = 0/49 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 ||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 344105 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 344057
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
343918
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
344098
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
28.62
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004167773.1

NW_004167773.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_38445, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 88.0 bits (80.6), Expect = 3.10E-13 Identities = 47/49 (96%), Gaps = 0/49 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 ||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 25979 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 26027
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
25979
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
26149
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
34.9
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004168305.1

NW_004168305.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_37911, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 88.0 bits (80.6), Expect = 3.10E-13 Identities = 47/49 (96%), Gaps = 0/49 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 ||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 84169 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 84217
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
84169
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
84349
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
28.83
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004169112.1

NW_004169112.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_37099, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 88.0 bits (80.6), Expect = 3.10E-13 Identities = 47/49 (96%), Gaps = 0/49 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 ||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 536 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 584
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
536
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
718
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
32.94
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004169421.1

NW_004169421.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_36788, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 88.0 bits (80.6), Expect = 3.10E-13 Identities = 47/49 (96%), Gaps = 0/49 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 ||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 12282 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 12234
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
12095
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
12277
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
38.27
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004169463.1

NW_004169463.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_36745, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 88.0 bits (80.6), Expect = 3.10E-13 Identities = 47/49 (96%), Gaps = 0/49 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 ||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 12617 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 12569
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
12430
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
12631
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
34.48
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004169463.1

NW_004169463.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_36745, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 44.0 bits (41.0), Expect = 2.72E-01 Identities = 31/37 (84%), Gaps = 0/37 (0%) Strand = Plus/Minus Query 86 ATATATTAAATGGATTTTTGGAGCAGGGAGATGGAAT 122 ||||||||||| | ||||| || |||| |||||||| Sbjct 47240 ATATATTAAATTGCTTTTTTGATGAGGGGGATGGAAT 47204
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
47127
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
47333
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-21.04
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004170546.1

NW_004170546.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_35661, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 88.0 bits (80.6), Expect = 3.10E-13 Identities = 47/49 (96%), Gaps = 0/49 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 ||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 24248 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 24200
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
24061
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
24243
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
33.56
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004170546.1

NW_004170546.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_35661, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 59.0 bits (54.5), Expect = 4.31E-05 Identities = 34/37 (92%), Gaps = 0/37 (0%) Strand = Plus/Plus Query 18 TGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTT 54 ||||||||||||||||| |||||| |||||||| ||| Sbjct 17615 TGGCTAAGATCAAGTGTGGTATCTATTCTTATCTGTT 17651
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
17598
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
17796
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-17.04
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004171308.1

NW_004171308.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_34896, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 88.0 bits (80.6), Expect = 3.10E-13 Identities = 47/49 (96%), Gaps = 0/49 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 ||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 22695 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 22743
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
22695
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
22867
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
33.31
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004171909.1

NW_004171909.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_34293, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 88.0 bits (80.6), Expect = 3.10E-13 Identities = 47/49 (96%), Gaps = 0/49 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 |||| |||||||||| ||||||||||||||||||||||||||||||||| Sbjct 22827 ATCGTTTCTCGGCCTATTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 22875
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
22827
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
23009
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
29.88
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004172693.1

NW_004172693.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_33506, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 88.0 bits (80.6), Expect = 3.10E-13 Identities = 47/49 (96%), Gaps = 0/49 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 ||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 38476 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 38524
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
38476
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
38658
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
32.47
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004174243.1

NW_004174243.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_31954, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 88.0 bits (80.6), Expect = 3.10E-13 Identities = 47/49 (96%), Gaps = 0/49 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 ||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 23935 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 23983
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
23935
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
24105
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
30.46
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004174243.1

NW_004174243.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_31954, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 69.0 bits (63.5), Expect = 8.31E-08 Identities = 45/51 (88%), Gaps = 2/51 (4%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAA--GTGTAGTATCTGTTCTTAT 49 ||||||||||||||| | |||||||||| ||||||||||||||||||| Sbjct 19461 ATCGCTTCTCGGCCTAATATCTAAGATCAAGTGTGTAGTATCTGTTCTTAT 19511
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
19461
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
19638
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
7.12
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004174362.1

NW_004174362.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_31834, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 88.0 bits (80.6), Expect = 3.10E-13 Identities = 47/49 (96%), Gaps = 0/49 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 ||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 27076 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 27124
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
27076
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
27246
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
30.54
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004174824.1

NW_004174824.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_31370, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 88.0 bits (80.6), Expect = 3.10E-13 Identities = 47/49 (96%), Gaps = 0/49 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 ||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 12381 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 12429
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
12381
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
12563
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
33.13
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004181381.1

NW_004181381.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_24794, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 88.0 bits (80.6), Expect = 3.10E-13 Identities = 47/49 (96%), Gaps = 0/49 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 ||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 1785 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 1833
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
1785
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1970
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
29.2
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004170168.1

NW_004170168.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_36040, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 86.0 bits (78.8), Expect = 1.08E-12 Identities = 46/48 (96%), Gaps = 0/48 (0%) Strand = Plus/Plus Query 2 TCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTAT 49 |||||||||||| ||||||||||||| ||||||||||||||||||||| Sbjct 28464 TCGCTTCTCGGCTTTTTGGCTAAGATAAAGTGTAGTATCTGTTCTTAT 28511
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
28463
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
28637
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
29.57
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_019218267.1

NW_019218267.1 Stylophora pistillata isolate CSM Monaco unplaced genomic scaffold, Stylophora pistillata v1 Spis.scaffold484, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 85.0 bits (77.9), Expect = 3.77E-12 Identities = 100/137 (73%), Gaps = 1/137 (1%) Strand = Plus/Minus Query 38 ATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATGGAT 100 ||||||||||||||| ||||||||||||| | | ||| | | | |||||||||| ||| Sbjct 138147 ATCTGTTCTTATCAGCTTAATATCTGATATGCTGCTCATTGAGTAGCTCATATATTAAACTGAT 138084 Query 101 TTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTATTGC 164 ||||||| | ||| ||||| || |||||| |||| ||||| | | | ||||| || Sbjct 138083 TTTTGGAACTGGGCTGTGGAAAAGAGGCTTGCCTCGTCCCAGCCACGGGTTGCCTCGGTATAGC 138020 Query 165 AGTACCTCC 173 | ||||||| Sbjct 138019 ACTACCTCC 138011
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
137998
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
138184
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
96.83
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_019218267.1

NW_019218267.1 Stylophora pistillata isolate CSM Monaco unplaced genomic scaffold, Stylophora pistillata v1 Spis.scaffold484, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 61.0 bits (56.3), Expect = 1.23E-05 Identities = 97/140 (69%), Gaps = 1/140 (1%) Strand = Plus/Minus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACG-TCCTCTATCCGAGGACAATATATTAAATG 97 || || ||||| |||||| ||||||||||||| | | ||| | | || |||||||||| Sbjct 165768 AGAATTTGTTCCTATCAGCTTAATATCTGATATGCTGCTCATTGAGTGGCTCATATATTAAACT 165705 Query 98 GATTTTTGGAGCAGGGAGATGGAATAGGAGCTTGCTCTGTCCACTCCACGCATCGACCTGGTAT 161 ||||||||| | ||| ||||| || |||| | ||| ||| | | | | ||||| Sbjct 165704 AATTTTTGGAACTGGGCTGTGGAAAAGACGCTTCCCTCCTCCCAGCCAGGGGTTGCCTCGGTAT 165641 Query 162 TGCAGTACCTCC 173 ||| ||||||| Sbjct 165640 AGCACTACCTCC 165629
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
165613
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
165802
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
75.59
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_019218267.1

NW_019218267.1 Stylophora pistillata isolate CSM Monaco unplaced genomic scaffold, Stylophora pistillata v1 Spis.scaffold484, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 55.0 bits (50.9), Expect = 5.25E-04 Identities = 31/32 (97%), Gaps = 1/32 (3%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGT 32 ||||||||||||||||||||||||| |||||| Sbjct 213938 ATCGCTTCTCGGCCTTTTGGCTAAG-TCAAGT 213908
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
213752
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
213957
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
0.02
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_019218267.1

NW_019218267.1 Stylophora pistillata isolate CSM Monaco unplaced genomic scaffold, Stylophora pistillata v1 Spis.scaffold484, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 50.0 bits (46.4), Expect = 6.39E-03 Identities = 30/32 (94%), Gaps = 1/32 (3%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGT 32 |||||||||||||| |||||||||||| |||| Sbjct 230891 ATCGCTTCTCGGCCCTTTGGCTAAGAT-AAGT 230861
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
230705
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
230898
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
2.87
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_019218267.1

NW_019218267.1 Stylophora pistillata isolate CSM Monaco unplaced genomic scaffold, Stylophora pistillata v1 Spis.scaffold484, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 49.0 bits (45.5), Expect = 2.23E-02 Identities = 26/27 (96%), Gaps = 0/27 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGAT 27 |||||| |||||||||||||||||||| Sbjct 81680 ATCGCTCCTCGGCCTTTTGGCTAAGAT 81654
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
81493
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
81681
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-0.09
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_019218267.1

NW_019218267.1 Stylophora pistillata isolate CSM Monaco unplaced genomic scaffold, Stylophora pistillata v1 Spis.scaffold484, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 49.0 bits (45.5), Expect = 2.23E-02 Identities = 26/27 (96%), Gaps = 0/27 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGAT 27 ||||||||||||||||||||| ||||| Sbjct 143444 ATCGCTTCTCGGCCTTTTGGCAAAGAT 143418
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
143257
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
143439
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-5.61
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_019218267.1

NW_019218267.1 Stylophora pistillata isolate CSM Monaco unplaced genomic scaffold, Stylophora pistillata v1 Spis.scaffold484, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 48.0 bits (44.6), Expect = 2.23E-02 Identities = 24/24 (100%), Gaps = 0/24 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAA 24 |||||||||||||||||||||||| Sbjct 99245 ATCGCTTCTCGGCCTTTTGGCTAA 99222
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
99058
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
99230
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-9.05
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_019218267.1

NW_019218267.1 Stylophora pistillata isolate CSM Monaco unplaced genomic scaffold, Stylophora pistillata v1 Spis.scaffold484, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 44.0 bits (41.0), Expect = 2.72E-01 Identities = 27/29 (93%), Gaps = 1/29 (3%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCA 29 ||||||||||||||||| |||| |||||| Sbjct 195627 ATCGCTTCTCGGCCTTTAGGCT-AGATCA 195600
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
195441
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
195630
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-4.17
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004170022.1

NW_004170022.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_36186, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 84.0 bits (77.0), Expect = 3.77E-12 Identities = 45/47 (96%), Gaps = 0/47 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTT 47 ||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 46664 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTT 46618
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
46477
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
46662
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
25.88
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004171893.1

NW_004171893.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_34309, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 84.0 bits (77.0), Expect = 3.77E-12 Identities = 45/47 (96%), Gaps = 0/47 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTT 47 ||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 17278 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTT 17324
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
17278
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
17467
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
27.33
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004173569.1

NW_004173569.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_32628, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 84.0 bits (77.0), Expect = 3.77E-12 Identities = 45/47 (96%), Gaps = 0/47 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTT 47 |||||||||||||||| ||||||||||||||||||||||||||| || Sbjct 19110 ATCGCTTCTCGGCCTTATGGCTAAGATCAAGTGTAGTATCTGTTTTT 19064
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
18923
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
19103
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
24.5
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004173569.1

NW_004173569.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_32628, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 67.0 bits (61.7), Expect = 2.90E-07 Identities = 59/74 (80%), Gaps = 4/74 (5%) Strand = Plus/Minus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGG 98 ||||||||||||||||||||||||||||| |||| | | | ||| || ||||||||| | Sbjct 17275 AGTATCTGTTCTTATCAGTTTAATATCTGGTACGCCGGCACATTCC--GGTTCATATATTAATCTG 17212 Query 99 ATTTTTGG 106 |||||||| Sbjct 17211 ATTTTTGG 17204
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
17122
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
17309
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
36.63
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004173569.1

NW_004173569.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_32628, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 43.0 bits (40.1), Expect = 9.49E-01 Identities = 26/29 (90%), Gaps = 0/29 (0%) Strand = Plus/Plus Query 40 CTGTTCTTATCAGTTTAATATCTGATACG 68 || ||||| ||||||||||||||| |||| Sbjct 37654 CTATTCTTTTCAGTTTAATATCTGGTACG 37682
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
37615
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
37801
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-21.75
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004174979.1

NW_004174979.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_31215, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 84.0 bits (77.0), Expect = 3.77E-12 Identities = 45/47 (96%), Gaps = 0/47 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTT 47 ||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 25586 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTT 25632
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
25586
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
25787
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
25.79
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004174979.1

NW_004174979.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_31215, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 84.0 bits (77.0), Expect = 3.77E-12 Identities = 45/47 (96%), Gaps = 0/47 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTT 47 ||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 28290 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTT 28336
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
28290
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
28476
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
28.04
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004174979.1

NW_004174979.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_31215, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 67.0 bits (61.7), Expect = 2.90E-07 Identities = 35/36 (97%), Gaps = 0/36 (0%) Strand = Plus/Plus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTC 70 ||||||||||||||||||||||||||||| |||||| Sbjct 18213 AGTATCTGTTCTTATCAGTTTAATATCTGGTACGTC 18248
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
18179
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
18365
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
31.42
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004174979.1

NW_004174979.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_31215, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 64.0 bits (59.0), Expect = 1.01E-06 Identities = 32/32 (100%), Gaps = 0/32 (0%) Strand = Plus/Plus Query 37 TATCTGTTCTTATCAGTTTAATATCTGATACG 68 |||||||||||||||||||||||||||||||| Sbjct 23498 TATCTGTTCTTATCAGTTTAATATCTGATACG 23529
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
23463
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
23650
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
35.85
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004174979.1

NW_004174979.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_31215, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 63.0 bits (58.1), Expect = 3.53E-06 Identities = 33/34 (97%), Gaps = 0/34 (0%) Strand = Plus/Minus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 ||||||||||||||||||||||||||||| |||| Sbjct 12536 AGTATCTGTTCTTATCAGTTTAATATCTGGTACG 12503
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
12379
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
12571
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
30.42
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004174979.1

NW_004174979.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_31215, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 62.0 bits (57.2), Expect = 3.53E-06 Identities = 58/74 (78%), Gaps = 4/74 (5%) Strand = Plus/Plus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGG 98 ||||||||||||||||||||||||| ||| |||| | | | ||| || ||||||||| | Sbjct 27957 AGTATCTGTTCTTATCAGTTTAATAACTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCTG 28020 Query 99 ATTTTTGG 106 |||||||| Sbjct 28021 ATTTTTGG 28028
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
27923
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
28111
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
51.18
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004174979.1

NW_004174979.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_31215, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 55.0 bits (50.9), Expect = 5.25E-04 Identities = 32/35 (91%), Gaps = 0/35 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTA 35 ||||||||||||||| ||||||| |||||||||| Sbjct 18544 ATCGCTTCTCGGCCTAATGGCTAAAATCAAGTGTA 18578
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
18544
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
18743
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
9.93
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004174979.1

NW_004174979.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_31215, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 53.0 bits (49.1), Expect = 1.83E-03 Identities = 31/34 (91%), Gaps = 0/34 (0%) Strand = Plus/Minus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACG 68 ||||||| ||||||| ||||||||||||| |||| Sbjct 2351 AGTATCTATTCTTATAAGTTTAATATCTGGTACG 2318
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
2198
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
2386
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
17.76
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004174979.1

NW_004174979.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_31215, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 47.0 bits (43.7), Expect = 7.79E-02 Identities = 34/41 (83%), Gaps = 0/41 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCT 41 ||||||||||||||| ||||||||||| | ||||||| Sbjct 23823 ATCGCTTCTCGGCCTAATGGCTAAGATCTTTAGGAGTATCT 23863
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
23823
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
24010
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
-3.9
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Not homologous
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Ambiguous base detected in uid:518|NW_004174979.1fw, violating base NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN, pos 147

Hit: NW_004174979.1

NW_004174979.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_31215, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 46.0 bits (42.8), Expect = 7.79E-02 Identities = 26/28 (93%), Gaps = 0/28 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATC 28 ||||||||||||||| ||||||||||| Sbjct 2018 ATCGCTTCTCGGCCTAATGGCTAAGATC 1991
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
1831
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
2031
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
2.98
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004184416.1

NW_004184416.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_21721, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 84.0 bits (77.0), Expect = 3.77E-12 Identities = 45/47 (96%), Gaps = 0/47 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTT 47 ||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 496 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTT 450
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
309
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
496
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
24.76
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004184416.1

NW_004184416.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_21721, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 84.0 bits (77.0), Expect = 3.77E-12 Identities = 45/47 (96%), Gaps = 0/47 (0%) Strand = Plus/Minus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTT 47 ||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 2842 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTT 2796
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
2655
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
2835
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
29.28
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004184416.1

NW_004184416.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_21721, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 67.0 bits (61.7), Expect = 2.90E-07 Identities = 59/74 (80%), Gaps = 4/74 (5%) Strand = Plus/Minus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGGATTT 102 ||||||||||||||||||||||||||||| |||| | | | ||| || ||||||||| ||||| Sbjct 829 AGTATCTGTTCTTATCAGTTTAATATCTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCTGATTT 762 Query 103 TTGG 106 |||| Sbjct 761 TTGG 758
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
676
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
864
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
56.02
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004184416.1

NW_004184416.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_21721, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 67.0 bits (61.7), Expect = 2.90E-07 Identities = 59/74 (80%), Gaps = 4/74 (5%) Strand = Plus/Minus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGGAT 100 ||||||||||||||||||||||||||||| |||| | | | ||| || ||||||||| ||| Sbjct 3174 AGTATCTGTTCTTATCAGTTTAATATCTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCTGAT 3109 Query 101 TTTTGG 106 |||||| Sbjct 3108 TTTTGG 3103
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
3021
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
3208
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
49.28
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004184573.1

NW_004184573.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_21562, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 84.0 bits (77.0), Expect = 3.77E-12 Identities = 45/47 (96%), Gaps = 0/47 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTT 47 ||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 1652 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTT 1698
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
1652
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1852
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
23.19
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004184573.1

NW_004184573.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_21562, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 67.0 bits (61.7), Expect = 2.90E-07 Identities = 59/74 (80%), Gaps = 4/74 (5%) Strand = Plus/Plus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGGAT 100 ||||||||||||||||||||||||||||| |||| | | | ||| || ||||||||| ||| Sbjct 1319 AGTATCTGTTCTTATCAGTTTAATATCTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCTGAT 1384 Query 101 TTTTGG 106 |||||| Sbjct 1385 TTTTGG 1390
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
1285
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
1473
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
55.8
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004185541.1

NW_004185541.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_20576, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 84.0 bits (77.0), Expect = 3.77E-12 Identities = 45/47 (96%), Gaps = 0/47 (0%) Strand = Plus/Plus Query 1 ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTT 47 ||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 486 ATCGCTTCTCGGCCTAATGGCTAAGATCAAGTGTAGTATCTGTTCTT 532
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
486
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
669
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
24.51
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.

Hit: NW_004185541.1

NW_004185541.1 Hydra vulgaris strain 105 unplaced genomic scaffold, Hydra_RP_1.0 HYDRAscaffold_20576, whole genome shotgun sequence

                        
?
This is BLAST alignment as read from the input file
Score = 67.0 bits (61.7), Expect = 2.90E-07 Identities = 59/74 (80%), Gaps = 4/74 (5%) Strand = Plus/Plus Query 35 AGTATCTGTTCTTATCAGTTTAATATCTGATACGTC--CTCTATCCGAGGACAATATATTAAATGGATTT 102 ||||||||||||||||||||||||||||| |||| | | | ||| || ||||||||| ||||| Sbjct 153 AGTATCTGTTCTTATCAGTTTAATATCTGGTACGCCGGCACAGTCC--GGCTCATATATTAATCTGATTT 220 Query 103 TTGG 106 |||| Sbjct 221 TTGG 224
sequence start
?
Start position of the estimated full-length sequence in genome.
Start index < end index.
:
119
sequence end
?
End position of the estimated full-length sequence in genome.
Start index < end index.
:
307
bit score (CM)
?
The score for aligning estimated full-length sequence to CM model
  (computed by RSEARCH -> default,
  infered from Rfam or provided by user)
:
57.31
Homology estimate
?
Quick homology estimate:
  Not homologous: bit score < 0
  Homologous: bit score > 20 and bit score > 0.5 * query length
  Uncertain otherwise
:
Uncertain ↴
Check the secondary structure and sequence viewer for supporting information about possible homology.
?
Click checkbox to select multiple seuqences.
Fasta header format:
  UID|accession.versionSTRAND start-end
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.
?
Visualisation of predicted secondary structure.
To save the image:
  Right click on the image -> Save Image as.